--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (68712 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (20 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        865        917   1   Terminal     53    53    Marginal
tccttcctgcattattttaagcaggctttggtggaagctgcttttcagcatttctattat
ttgtttttcttcctcccgcagtggggcggggagctgcactggctctcccacgcgtctatg
ccgcgctgttgccgcagattattattgtagtcttttgcaaaaccctttccttcttcccag
CCAGTCCCCGCGCAGACTCTCACGGCTACGGCAACCGAGTCGTGCCCCTCTAG
tgggaaggcgagagcgagggtcccttgctttcgcccgagctcccggaccccgcggttcaa
ttgtttgaaacttccacgccccccggccccgcctctcttccgcgctcccctcactcctca
cttccagggtccaggcaggctcccgcccttctttccccgccctctactccgccttcctcc

Exon  2 +       1853       1920   0   Internal     68    53    Marginal
atgcccgtgtgttctactttctttgcagctcgccatgagtttttttggatgtgcagcaag
ttaaatcggttagagtgtgcgctgctttcccgtcctacttcggtgaggagatgctagtgg
gtaccactactagatggtacttttacttctttacctcctggggttcttgtgggtctctag
GTAATTAATCACATTGAGGAGCTAAAGACCCGAGGGAAGCTGAAATCTACATTTAGCCCA
GCATGCAT
gtcagtgcttatctcagataactagataggtttctgctaagtgcttaggcttggggtggg
gactcacactccctgaggcgggagcaggaggggtaggaccgtgaattcttgaagttttaa
agtctgtgtaatctaaaacaaggctactctttgagatgtgtggtggtggtggtagtgctt

Exon  3 +       7636       7935   0   Terminal    300    58    Marginal
cccaaaagaaacattaagataacatgaaatataaatgtggccaagctagaaagggtggat
ttggtggagagtctcccttcttcttattggtgtcacatcagatcacaataactgtgccgc
ccccctatcaaccttaggcattgatactgatctttttttccccttatatataccccatag
CAAACTTCACATTTCAATCTTTTTGATATGGACAAACGATCTGCTCTCCTCTTTATAATG
CAGATAAAACTGATGTATGTGTTTTTTAAGAGCATATTTTCCCTGCACATGCTTCTCATT
ATCCGAGAGGCCTGGACTCAATCAGTAAAGGAGCAGAGAAACCACATAATTGAAAGGAGA
ATGACGGTGGTGCATACTTGGAATATTTGTGGGAAGGGGATTGCTGACATCAGAAAATGT
AGTGGCCTGAGTGTTAACAGCATTGAAGAGAAATCAGCTTTCTGTGTTTCTGTGTATTGA

aaattatttttaagggaataaaaatatgggccaggtttgacatccttttatgaagttgcc
ctggaaactttgatgaagattgttaaagaatagctcaattaaaaccttccccattaggaa
gctaattagtacatcccttactcattttggttgttttcaaggggcatgtatttgcattga

Exon  4 +      19586      19761   0    Initial    176    75        Good
tccttgagtgaacgactaatgcagatgtcactggccaccagtggagttaaggcccatcca
cctgttaccagtgctcccctctccccaccacaacccaatgacctctacaagaatcccaca
agttccagtgaattctacaaggcccaagggccacttcctaaccagcatagcctgaagggc
ATGGAACACCGAGGCCCCCCACCAGAATATCCCTTCAAGGGCATGCCACCCCAATCTGTA
GTGTGCAAGCCCCAAGAGCCAGGGCACTTCTATAGTGAGCATCGCCTGAACCAGCCAGGG
AGAACAGAGGGGCAACTGATGAGGTATCAGCATCCCCCTGAGTATGGAGCAGCCAG
gtaagagagttctgtttctgtcatttcctgacctcatccccaaccagcttctgctgtgtg
ttgggaatcttagggaaggaacgggcaggtgtttgatataacaaactctgcaatgcatga
caggcctctggcttcgtgaattgcctgccaacccgaatttgtatcctctttagccataat

Exon  5 +      26139      26255   0   Terminal    117    80        Good
gtggtctttgcagagatagagcaggcagggttagacttccccatagtcagaccctgcctg
ctcttcattttgcaggtgtcctgggggcatcagaagcctcctcatctcacttttgtgtgc
ccttctcccccagtgccttaggagagaaattaacccgcacctgcccttcatgttttacag
GCCAGCGCAGGACATCTCATTGCCATTGTCAGCCAGGAACTCGCAGCCTCACAGCCCTAC
TTCTTCTCTGACCTCTGGGGGGTCCTTGCCCTTGCTACAATCTCCACCATCCACTAG
attgtctcctgcccgacaccccttggtcccaaaccagggagaccattcagctcacctgcc
taggccgcagcagcatttccttcctaatcaggctcaccagggggatcattaccgtctctc
ccaacctggcctgagtcagcagcagcagcaacagcagcagcagcaccatcatcaccatca

Exon  6 +      26565      26658   2   Internal     94    84        Good
cctgagtcagcagcagcagcaacagcagcagcagcaccatcatcaccatcaccaccaaca
acagcagcagcagcagccacagcagcagccaggagaagcctattcagctatgcctcgggc
tcagccatcctctgcttcttatcagccagtgccagcagacccttttgccattgtttccag
AGCCCAGCAGATGGTTGAGATCCTCTCAGACGAGAACCGGAACTTGAGGCAAGAGTTGGA
AGGATGCTATGAGAAGGTGGCAAGACTGCAGAAG
gtgaggcttccgttttgggatattagggtctctaagtctttatttgtgagacttgtttaa
tatccacattaaagtctccagttgtgaatcccagcattacttgtggcaggtcttcaggat
ttttatatctgaaggttagatatgagtcaaactttggaaaaagccttctacctgtctacc

Exon  7 +      30566      30767   0   Internal    202    72        Good
attgtctatttttttaacccgaggaaagaccatgacaccatgagttaattactaagctta
tggttgaaggtggagatcctttcttgaaacttgtgtcatctgactgtgttatgcttgcct
cctggccatctgtgagccctgggagaagctgtcagcgaggatttgcctgtttgttttcag
ACCATTTTCCCCATCACCCTCCTACCATCACCACCATTGTCTTTTTTTGTTGTTAAGGTG
GAGACAGAAATCCAGCGCGTCTCGGAGGCATATGAGAACCTCGTGAAGTCATCCTCCAAA
AGAGAGGCCCTAGAGAAAGCCATGAGAAACAAGCTAGAGGGCGAGATTCGGAGGATGCAT
GATTTCAACAGGGATCTGAGAG
gtgagggaaccaacagacttgtctttgtacttctgaagcagctgcagggtggtgaaggga
agggctgagcaggatccaactaggctctttggggttgtccaacccaccggtatgggcagt
aaatggctgggcatgtgccaggctaattttttgtgactgcaatagtcctcagtcccaagc

Exon  8 +      32030      32122   1   Internal     93    96   Excellent
tccccggccatggtctagtattattttgggattcacatttgcaaactcatgttagtcacc
cattcctgtttaacaagaagaaacaggcttgttttaccaaaggtcagtatttagagggcc
aatagtatgtgcatgaaagtttacatttgagaccctgttgattgtctccaaatttcacag
AGCGTCTAGAGACTGCCAACAAGCAGCTTGCAGAGAAGGAATATGAGGGGTCAGAGGACA
CCAGAAAAACCATCTCGCAGCTCTTTGCAAAAA
gtaagtctgcaagctgcagaaacaggtattaacgtgtggatgggagcaaggtgcgtgaaa
agattacactgttctctttagccttttagaacagccagggcagagtcaatatcacctaag
gattgtttttcctattcaggcatgaagttggaagattctgttcttttcctcctaagccaa

Exon  9 +      32262      32401   1   Terminal    140    56    Marginal
agaggacaccagaaaaaccatctcgcagctctttgcaaaaagtaagtctgcaagctgcag
aaacaggtattaacgtgtggatgggagcaaggtgcgtgaaaagattacactgttctcttt
agccttttagaacagccagggcagagtcaatatcacctaaggattgtttttcctattcag
GCATGAAGTTGGAAGATTCTGTTCTTTTCCTCCTAAGCCAAGAAGGCTGCTTGCCACAAC
ATCTCGTCACATCACATTGGTCCTTCAGCATTAAACTAGAGAAGCCCCTTGAAATCCCTG
CTAGTGTCATTGCTATCTAA
ataaagaggcttactgaacatgaggtcccttcatgttgaagggattttcttagaagaaac
tgtgtgttggctctggtagagatgggattaatatgcaggatcgatgatagtgtttggaat
acttcacctgtacctggggctccctagtatttattgttacacagcagcagattgcaaggg

Exon 10 +      36905      37150   0     Single    246   100   Excellent
tgttaagtgacttttctgaatttctacaacaagttagtgagagagccagtgatagagtcc
agatcttgggtatactggttcttcagctgtgcactagagcagtaggctatctagtaaagg
gtatgatgtgtcaattttgctcaggtaaggctttgagctagctccaggctggcagtgttg
ATGTTTAATGTCCTGACAGATAAAGAAAGCCAGCGTGAGAAGGAGAAGCTGGAAGCGGAG
CTGGCCACTGCCCGTTCTACCAATGAGGACCAAAGACGACACATCGAAATCCGAGATCAG
GCCCTGAGTAATGCCCAGGCCAAGGTGGTAAAGCTGGAAGAAGAGGTATGGTTTCCTCAG
GTAGCATATGAGCCTGGGGGTGGGAGGGCTGGGAAATCGGGGACACTGGGCTCCACATTG
TGGTGA
attggcagctgcataatccccagaagggaggtgccatctgctgctcctagtttccactgt
gctgatgtgagtggactttgctttcttttctcttcttggtaaattcttttcttttgctcc
aaaataggaaatcaccagggtcaagaaacagtttccatttgttcattcatataataagct

Exon 11 +      40823      41026   0    Initial    204    52    Marginal
taaatggtgcctttccgtccttgcccttatctttctttcgggacacgtaggtcctattga
agtggaggctcattaaactccaagtcaaaagagctctgtgtcctacagcaaccacggtat
tctcccattcaaagacagcctccccaccccctaccaatttgacctcgctggagattttcg
ATGGATGTCTGGCATATCCTCTCACAAGGCTCAGGGCAGCCCAGGCTTCTGGCTGGCTGC
TGTCTTATGATGATCCGGAGTGGAAGCGGCTTGGGTAATTGTTTCAGGGATGGTGGGAAA
AAGGCCTTGGCAAGATCAAAGAGGGAAGATGCTGCGGGTGGGCTGCTTACTGAACTGAGT
GCACAGGAAGGGAGAGTGTGGAAT
gtgagagggctggcagagagagccagtgagccttgttctttggctttaggctagaatgaa
agccatggagattcaacaagaaggggcccaaatgttaaccttttctgaactgcagtggct
agtgatgatgtagatgtcacattgatagctcgtattggagtagccagtgcattttctgga

Exon 12 +      48324      48408   0    Initial     85    41    Marginal
agtcagtgttgttataaacagccacaaatcccggggaagaaaggtttaaacttactgagg
taaagagtttgatggtgttttgtttgttttatttcctaggaaaagttctaatggataaaa
acatataggcttcgaactcacctcaactggttttcaaggctagattgaactagacttgga
ATGAAAGGAAATGTCAAAGAAGTACAACAAAAGTCGAAAAAGGTTTTGTTTGCCAGTTAC
CTAGGCAAGGCATACTACAGGTCTG
gtaggaaaatacaagatagggttccttcgacttagagaaagttcagcaattctaatttga
ggagggggccattataagacaaagagggtttttctatcactacatgctagtgctgtctga
ctggaaattctaccaagtagtgatttggactcattaccatgaaggtttctgcaatgaggg

Exon 13 +      50035      50184   0   Internal    150    98   Excellent
caatacaaggcagcctgctactcattgtgaaggaccttctcgccatccattcctttttgc
agctggactctaaaacaagaagagatctaaacacaaggctggatttaggggatacataat
tgaccctgttgcttgctgtttttcctttcaccttgcaaattacccaacatggatttccag
CTGAAAAAGAAGCAAGTGTACGTTGACAAGGTGGAGAAGATGCAGCAGGCCCTTGTACAG
CTCCAGGCAGCATGTGAAAAACGTGAGCAGCTAGAGCACCGTCTCCGGACACGACTGGAG
AGGGAACTGGAATCCCTGAGAATCCAGCAG
gtatggagaacttaaaggaagaaagggaaaaaaaagtaagaaaatgacattattcctggt
tgcttatttttcagttagcatttgacatgaacactgaaagcacacacttgctcattttta
catttttctcccacctaatcttactccagagtgcctcccaattgtgaatacaaagtctgt

Exon 14 +      51234      51424   0   Internal    191    98   Excellent
attcaagcccatgataggaagtcctgtggccctgggaggagatctgaattccccctgctt
ctttctgaatcagagtcgaaacagaagtaggctgggcagtaatcctctccaagaataggg
gctcagacaccatggttcttctctcactaacttgagggttctctgcatctgccccaacag
CGTCAGGGCAACTGTCAGCCCACCAACGTTTCAGAATACAATGCTGCTGCACTGATGGAG
CTCCTTCGGGAGAAAGAGGAGAGGATTCTGGCTCTGGAAGCTGATATGACAAAGTGGGAG
CAGAAATATTTGGAGGAGAATGTGATGAGACATTTTGCTCTGGATGCTGCTGCAACTGTG
GCTGCTCAGAG
gtaagtaggtagctggtagggcatgagtgggaagaacagaaaggtcactgattcatagat
ttttccagtgttttattttctttaatattctgggtttcccccccaatttctgcctaagtg
tgttttctttcatctgattatgcagggaatgaacggctgtagagacagagggtcagggat

Exon 15 +      54974      55053   0    Initial     80    44    Marginal
cttttctcaggtgataagtcgtattaggtggtctatttataccccttccaacactttgat
attatgatacacctcttgtcaaagggaaagctgttgatgttaacgatttcagacaagatc
agagcgtgaaaacctaggtttttagccttaaagagtccaggaggaggcattttgatgcat
ATGGAAAGTGCTGGCATTGCCCTTTATCCTGAGATGCATCTTAAACATCAGATACAGCAA
CTCTGTGAGATTGGTCAGCT
gtatgtttaggtgaattttccttgatgaaaggttaagagggccaagagataaagagaaag
agagagaaaattgaagatattttggcatatctaaaatgagtatttgatacttaaaatatt
tgttttgttcaaagtgataacaggaaatttatttctttcattttatttagataatttgcc

Exon 16 +      59354      59476   2   Internal    123   100   Excellent
gaacgctgaactgtcctattttggaggctcttacgggttagttccccagaaaccatctgt
tccaaatgtgcttgatttcagcttaggactttccagaaaagccttccttgacttagaaga
aagataacattcattgatcttgctatgctcccatctcatcacttccattttcctccccag
GGACACAACAGTCATCAGTCACTCTCCTAACACCAGCTATGACACAGCTCTAGAAGCTCG
CATCCAGAAAGAGGAGGAAGAAATCTTGATGGCCAATAAGCGTTGCCTTGACATGGAGGG
CAG
gtaaaatgttgttctggaccctgaggaatctgagacattgatatagagaccacataggat
ctttattcacagctaggaaatctgatcatgcagcctccccgctccaccatcacccctgcc
agcctgtcacttaaaggtgtgagatgcaatgacctttaccttgataatctccactaaaca

Exon 17 +      60898      61130   2   Internal    233    99   Excellent
ccagctaatttttgtgtttttagtagagacagggtttcaccatgttggccaggctggtct
cgaactcctgactttgcaatccgcccacctcggcctcccaaaatgctgggattacaggcg
taagccaccgcgcccagcccacaacaaggtctttatatgttctttgcctttggctcctag
GATTAAGACCCTCCATGCCCAGATTATTGAGAAGGATGCCATGATCAAAGTACTCCAGCA
GCGTTCCCGGAAGGAGCCGAGCAAGACAGAGCAGCTGTCGTGCATGCGGCCAGCGAAGTC
TCTGATGTCCATTTCCAATGCTGGATCAGGCTTGCTCTCCCACTCATCCACCCTGACTGG
CTCCCCCATCATGGAAGAAAAGCGAGACGACAAGAGCTGGAAGGGGAGCCTAG
gtaatgacagtaaataaggaagattatagtcacgtgttcaaagagagccctgagataagc
acccatgcttaaggaaaagggatgatggtccaggttctagagaggaaggtgtaccagggt
tttggagtttttttttcctcctgagaccctagttccacattctggagctcctccacactt

Exon 18 +      62336      62695   1   Internal    360    70        Good
cttagactattctaaattatttaatatttaaaaataataatattttaaatatttaaataa
tatttacttatttaaaaataaataaatttcttctgaaatttgaatgggagaacaggtaat
tagatgtctggatttgaatcacctattgttttctaacatctgttcctctttcatttgtag
GCATTCTCCTGGGTGGAGACTACCGTGCTGAATATGTCCCTTCCACACCCTCGCCTGTGC
CACCCTCGACTCCCCTGCTCTCGGCTCACTCCAAGACAGGCAGCCGAGACTGCAGTACCC
AAACTGAACGTGGGACGGAATCGAACAAAACTGCAGCTGTTGCTCCCATCTCTGTTCCTG
CTCCAGTTGCTGCTGCCGCCACTGCTGCCGCCATCACTGCCACTGCTGCCACCATCACCA
CCACCATGGTAGCTGCTGCTCCAGTTGCTGTTGCTGCTGCTGCTGCTCCAGCTGCTGCTG
CTGCCCCGTCTCCAGCCACTGCCGCTGCTACTGCTGCTGCTGTTTCTCCAGCTGCTGCTG

gtcagattccagctgctgcctctgttgcctcagctgctgccgttgctccttctgctgctg
ctgctgctgctgttcaggttgctccagctgctccggctccagttccagctccggctctgg
ttccggttccagctccagcagcggctcaggcttctgctcctgctcagactcaggcaccaa

Exon 19 +      62773      62925   1   Internal    153    63    Marginal
gctccagttgctgttgctgctgctgctgctccagctgctgctgctgccccgtctccagcc
actgccgctgctactgctgctgctgtttctccagctgctgctggtcagattccagctgct
gcctctgttgcctcagctgctgccgttgctccttctgctgctgctgctgctgctgttcag
GTTGCTCCAGCTGCTCCGGCTCCAGTTCCAGCTCCGGCTCTGGTTCCGGTTCCAGCTCCA
GCAGCGGCTCAGGCTTCTGCTCCTGCTCAGACTCAGGCACCAACTTCAGCTCCGGCTGTG
GCTCCAACTCCAGCTCCAACTCCAACTCCAGCT
gtggctcaggctgaggttcctgcaagtccagctaccggtcctggaccacatcgtttgtct
ataccaagtttgacctgcaatccagacaaaacaggtaattattccctttagcaggtaggt
tttggtttagttctgctctcaaatacagatttatttcttgttgtctgatgtctgggcaga

Exon 20 +      63352      63449   1   Terminal     98    84        Good
atccaccaagatgggaacaggcatgagtagaggccattatcttagcagaagtaaatgagg
gaggtggcaggcaagtctcactttgccattggcttcatgagggctctgatggtgtctggt
tctagaaatatgggttttttcttcatccctaagtgttttctaacccttatttccatttag
ATGGGCCTGTGTTCCACTCCAATACTCTGGAAAGAAAAACTCCCATTCAGATCCTGGGAC
AAGAGCCTGATGCAGAGATGGTGGAATATCTCATCTAA
acggccaaatcaagagctgcagattatcagcaaaaatgcttttaatcattttcccccttt
tattggttcttgttttgagggtgaggacaagggttgtggggaggggatgttttttaacag
gactttttattggaacaatgtactacttgagtaataccatgtgaacaccagtctattttg

--------------------------------------------------------------------------------