GENSCAN 1.0	Date run: 17-Jan-104	Time: 05:41:29

Sequence COX7B_1 : 8320 bp : 41.91% C+G : Isochore 1 ( 0 - 43 C+G%)

Parameter matrix: HumanIso.smat

Predicted genes/exons:

Gn.Ex Type S .Begin ...End .Len Fr Ph I/Ac Do/T CodRg P.... Tscr..
----- ---- - ------ ------ ---- -- -- ---- ---- ----- ----- ------

 1.01 Term +   1214   1277   64  2  1   65   33   137 0.627   2.28
attcttcattagataccacccaccatacgtcattttataaagccggaaactacatttccc
aaaaggcctttatttttcctcgcgggaaaagggattgcaattactataggttttacaggt
atcgcgagatttcgtcaaatctcattacggatcccggctgaaagccattttgtttttcag
CTCACTTCAAGGGTACCTGAAGCGAATTGGCACCAAAGCAGCAGCTGTATTGCCGCAGTT
CTAG
cttcaccttcacgatgtttcccttggtcaaaagcgcactaaatcgtctccaaggtgagca
aaaattatgacaaatcatttacaacaaccttatatcaatgtgtcctcgcggcctctcgtg
tgctttccttttacgaacatctcggccttctaatcttgaatgctgtctgtctcccatctc

Predicted peptide sequence(s):


>COX7B_1|GENSCAN_predicted_peptide_1|21_aa
XSLQGYLKRIGTKAAAVLPQF