Gene TRAF1 Variant 1
DNA : 22.20 KbNT_008470
mRNA : 2395 bp NM_005658
CDS : 1251 bp NP_005649
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  218 bp
aaaaaaaaaaaaatgactggacactcctaaagccttcagtcaccatccaggggattttta
tcgccacaaagggtaattcctgctccatccctgctgtgactcagctgtgacgttgaacca
cacaagccagagagaagaagataaagtcatcagagctcctactcaccagagagtgaggcc
CAGGCCAGGACTCCACAAGGCTGGTCCCCTGCCCTGGAGCAACTTAAACAGGCCCTCTGG
CCAGCCTGGAACCCTGAGATGGCCTCCAGCTCAGGCAGCAGTCCTCGCCCGGCCCCTGAT
GAGAATGAGTTTCCCTTTGGGTGCCCTCCCACCGTCTGCCAGGACCCAAAGGAGCCCAGG
GCTCTCTGCTGTGCAGGCTGTCTCTCTGAGAACCCGAG
gtgaggtgatggaggagcggagggtgggcagaaagtgggtgccagggagggacccctgat
gggaggtgaggggcagaggagcctgtgacttcaggcggtgacttttcttctctgggcctc
agtttccacacccttttctcacactccctgacactgcccctctggctgtggtggaaggag
EXON 2  88 bp
caaactaccaaaaaatgtgggatactcggcagttttgcgatttaggaactgtggctctgg
gattgtggacgtacatgatcaccaccctgctgatagttgaggcttctggagctgtcagga
gagtggatggtgcagggagctgtagtgcctctctccaaggctttgtccatgtttccccag
GAATGGCGAGGATCAGATCTGCCCCAAATGCAGAGGGGAAGACCTCCAGTCTATAAGCCC
AGGAAGCCGTCTTCGAACTCAGGAGAAG
gtacgttggcacatcacagaaaggcatttgtccgttgtcttgatttttccaggttgaagc
caagtagacagctgcccactccacccctggcaggcacctcccaactagtcctgagtccag
actgaatttgctttataaggaataaggagactgatgttcacagtggtgaagtgtcttgcc
EXON 3  66 bp
aaggtcatggaagggtggaagcttaaagggtggaaaggagatagccaaagggaacagcag
tgtgcaaagtcatgtggcccaagccatctcctgccctggtggatcctggtgcattgaaga
gagccccagggtagccacagggatcgctataacattcagtgatgtgattattatttccag
GCTCACCCCGAGGTGGCTGAGGCTGGAATTGGGTGCCCCTTTGCAGGTGTCGGCTGCTCC
TTCAAG
gtaagcatctgagtgtgagaaaggagatctatccactatggttccagacctccaggtctc
cccactgcagcccctccatgattttcccgtaacatcagtccactcatctggatgtccttt
gtactaatgactttcccaagcatcagagcctactattaagtcatcacagtactcagggaa
EXON 4  411 bp
tcatcgtgggcatgtctgatgccagggtcttcctctgaatccctcccactgtacagaaag
ccactcctttttgctgggtgaatgaataatccttggtgacctttgatagcagggcactcc
actgctcccctgtcctcactccacctctgttttcactgatcagccccactctcttgtcag
GGAAGCCCACAGTCTGTGCAAGAGCATGAGGTCACCTCCCAGACCTCCCACCTAAACCTG
CTGTTGGGGTTCATGAAACAGTGGAAGGCCCGGCTGGGCTGTGGCCTGGAGTCTGGGCCC
ATGGCCCTGGAGCAGAACCTGTCAGACCTGCAGCTGCAGGCAGCCGTGGAAGTGGCGGGG
GACCTGGAGGTCGATTGCTACCGGGCACCCTGCTCCGAGAGCCAGGAGGAGCTGGCCCTG
CAGCACTTCATGAAGGAGAAGCTTCTGGCTGAGCTGGAGGGGAAGCTGCGTGTGTTTGAG
AACATTGTTGCTGTCCTCAACAAGGAGGTGGAGGCCTCCCACCTGGCCCTGGCCACCTCT
ATCCACCAGAGCCAGCTGGACCGTGAGCGCATCCTGAGCTTGGAGCAGAGG
gtgagtgtgggaggcaggtttgccttcaagcccggctgagccccatcctgtctccagagc
ggcagacaggcttcctcctaatcattcatcctgcttacagcagtcactccatcaaaacgt
atctcccctttatcccacacccttccaggaagagcgctgagttagaagctgtagtcaagg
EXON 5  178 bp
cctggtggataaggaaaaggaaggccaggcagggggcagcacattcagatgcagacgcac
acctgagtgaggcgtggtcagcaaaacacatctggggcagatcaatctccacatcccgcc
attcccatcccatccccaagccgggttctggtgttcctggctgaacagtcttccctacag
GTGGTGGAGCTTCAGCAGACCCTGGCCCAGAAAGACCAGGCCCTGGGCAAGCTGGAGCAG
AGCTTGCGCCTCATGGAGGAGGCCTCCTTCGATGGCACTTTCCTGTGGAAGATCACCAAT
GTCACCAGGCGGTGCCATGAGTCGGCCTGTGGCAGGACCGTCAGCCTCTTCTCCCCAG
gtaacacctcccaggggcacagagacctgcctggggaaacaggccccacaggacccagga
agcaagcagtgaaaactgccagctctgtgacagacacgctgtgtccagtttaggccagtg
cccattcaggccactcaccatgggcaggaaccatgctgggatcttcaggttggtgggtga
EXON 6  149 bp
agctagatgacccccaagagcccattcctgtctgacaccctactcgagaagaatgctggg
ttctaaccccatctttcatggttttgagccgctgaccttgggcatgcctgaccactggat
cccagtcccacatctgcaaagtccagcacttcccaactgcctctggcttctgcgtttcag
CCTTCTACACTGCCAAGTATGGCTACAAGTTGTGCCTGCGGCTGTACCTGAATGGAGATG
GCACTGGAAAGAGAACCCATCTGTCGCTCTTCATCGTGATCATGAGAGGGGAGTATGATG
CGCTGCTGCCGTGGCCCTTCCGGAACAAG
gtatgggtgtgaaggtgatgggggtaaggtggggagcatggaagcctgagtcctagtcct
ggtttggcaatgaattggccatgtgacctggcaagtcccccaccctctctgtgttatcag
tttccctttttataaaacaatcagatctagtaactagggctccctccagctccatgagtc
EXON 7  1285 bp
gtctggccatacgccaggtgcgctccttacttggtttctctgactcctaatccaaatgag
ccaagggtctgaggggctgcacaggcagtaggtgtggagcacagctctgagcccaagcct
gggcctccaagctgcgctgctgctgtagggcctgatctcccacctatcccttccctgcag
GTCACCTTCATGCTGCTGGACCAGAACAACCGTGAGCACGCCATTGACGCCTTCCGGCCT
GACCTAAGCTCAGCGTCCTTCCAGAGGCCCCAGAGTGAAACCAACGTGGCCAGTGGATGC
CCACTCTTCTTCCCCCTCAGCAAACTGCAGTCACCCAAGCACGCCTACGTGAAGGACGAC
ACAATGTTCCTCAAGTGCATTGTGGAGACCAGCACTTAGGGTGGGCGGGGCTCCTGAGGG
AGCTCCAACTCAGAAGGGAGCTAGCCAGAGGACTGTGATGCCCTGCCCTTGGCACCCAAG
ACCTCAGGGCACAAAGATGGGTGAAGGCTGGCATGATCCAAGCAAGACTGAGGGGTCGAC
TTCGGGCTGGCCATCTGGTTAGGATGGCAGGACGTGGGCTGGGCCCACAAAGGCAAAGGG
TCCAGAAGGAGACAGGCAGAGCTGCTCCCCTCTGCACGGACCATGCGACACTGGGAGGCC
AGTGAGCCACTCCGGCCCCGAATGTTGAGGTGGACTCTCACCAAATGAGAAGAAAATGGA
ACCAGGCTTGGAACCGTAGGACCCAAGCAGAGAAGCTCTCGGGCTAGGAAGATCTCTGCA
GGGCCGCCAGGGAGACCTGGACACAGGCCTGCTCTCTTTTTCTCCAGGGTCAGAAACAGG
ACCGGGTGGAAGGGATGGGGTGCCAGTTTGAATGCAGTCTGTCCAGGCTCGTCATTGGAG
GTGAACAAGCAAACCCAGACGGCTCCACTAGGACTTCAAATTGGGGGTTGGATTTGAAGA
CTTTTAAGTTTCCTTCCAGCCCAGAAAGTCTCTCATTCTAGGCCTCCTGGCCCAGGTGAG
TCCTAGAGCTACAGGGGTTCTGGAAACATTCAGGAGCTTCCTGTCCTCCCAGCTCCTCAC
TCACCTTCAGTAACCCCCACTGGACTGACCTGGTCCACAGGGCACCTGCCACCCTGGGCC
TGGCAGCTCAGCTTCCCCAACACGCAGGAGCACACCCAGCCCCCACATCCTGTGCCTCCA
TCAGCTAAACACCACGTCACTTCATGCAGGTGAAACCCAGTCACTGTGAGCTCCCAGGTG
CAGCCAGAGGCACCTCAAGAAGAAGAGGGGCATAAACTTTCCTCTTCCTGCCTAGAGGCC
CCACCTTTGGTGCTTTCCAGAATCCCGTAACACCTGATTAACTGAGGCATCCACTTCTTT
CAGCAGACTGATCAGGACCTCCAAGCCACTGAGCAATGTATAACCCCAAAGAAATAATTT
TTAGAATCTCTTTCGAAGTTTTCCT
aaagtgtatggtttgggagttgtttgtactgagccaggtttgaaaaggccattgctgagt
ttgaggtggtgccaccagttttgcaggtggcatcagaggctggcatgctggcaggaacat
cccctcttagccccagtcttctcttttctataatgagacccaccccagcttgcctccctc