Gene SLC27A4 Variant 1
DNA : 17.36 KbNT_008470
mRNA : 1932 bp NM_005094
CDS : 1926 bp NP_005085
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  161 bp
cccttccaggccaagcctggaaagggacccctgtggtcagtcacccaactcagtatggct
aagccttaccacaggctgtccccttgggatcacagtggcctggctgtctgggctgggagg
taggagacctggagggttgggtgtttgggtccactaactgccctgtgtccgcaggccaca
ATGCTGCTTGGAGCCTCTCTGGTGGGGGTGCTGCTGTTCTCCAAGCTGGTGCTGAAACTG
CCCTGGACCCAGGTGGGATTCTCCCTGTTGTTCCTCTACTTGGGATCTGGCGGCTGGCGC
TTCATCCGGGTCTTCATCAAGACCATCAGGCGCGATATCTT
gtgagtacctggcccagcctttcctggggtctgccacactacagtgagcttctggtcccc
caaatctccccaggccagacctcatgttctctaccagcacagggcagctgagctgagttc
cagaacagcagcctctgctccacacccgtaccctggcaatagtacctggtccctccatct
EXON 2  395 bp
gtgttattgagaggcatcagtaaggcagtgcatgttcccagcaggagccaggagatagaa
gtgttgtagggggtctggctcatgaagcataggctggcgaggcagcagcctggggtaggg
tgtcaggacccctccctcccaaccatggcagacacagcgccctctcttgttcacacacag
TGGCGGCCTGGTCCTCCTGAAGGTGAAGGCAAAGGTGCGACAGTGCCTGCAGGAGCGGCG
GACAGTGCCCATTTTGTTTGCCTCTACCGTTCGGCGCCACCCCGACAAGACGGCCCTGAT
CTTCGAGGGCACAGATACCCACTGGACCTTCCGCCAGCTGGATGAGTACTCAAGCAGTGT
AGCCAACTTCCTGCAGGCCCGGGGCCTGGCCTCGGGCGATGTGGCTGCCATCTTCATGGA
GAACCGCAATGAGTTCGTGGGCCTATGGCTGGGCATGGCCAAGCTCGGTGTGGAGGCAGC
CCTCATCAACACCAACCTGCGGCGGGATGCTCTGCTCCACTGCCTCACCACCTCGCGCGC
ACGGGCCCTTGTCTTTGGCAGCGAAATGGCCTCAG
gtgagccccaagggggcgggggacaagcaggaaccccatgggatcttacacagaccacag
ctcccttccagccctgccaaggctgtgtgggtcagtggttaagggcacagagtggagtca
gacagcttaggcagtgccacgagtaaacgagatcctggggaagggactgatttctctgag
EXON 3  159 bp
gcccatggctaatagaaccattgccggtgcccctgtcaacactgaaggcccagttgcttc
actgcctctcctcctgcccagccagtatcctcagcaacatggccagccctgctgggagca
gaggtccctgggaacatggggttttctggcctgcctgctgactgccctgtctccccacag
CCATCTGTGAGGTCCATGCCAGCCTGGACCCCTCGCTCAGCCTCTTCTGCTCTGGCTCCT
GGGAGCCCGGTGCGGTGCCTCCAAGCACAGAACACCTGGACCCTCTGCTGAAAGATGCTC
CCAAGCACCTTCCCAGTTGCCCTGACAAGGGCTTCACAG
gtgggctccatcccctccccatagaggggctctcacacaggccctggacagagcactggc
ctcagtgccagaaggaggcttttctggaaacttgccatgtgcctggaacatgtcacgtca
cctccctttttccatctggaaaatggtgacagtaaacctgggccactccagggttactgt
EXON 4  70 bp
ttgttggaatggatgccggtgttagagctgaatggtatctgaggttatcagaacaggctt
cctagcaagggtgtgatgggaacaggtgttgaagggtgcacacctgcaggtgtccatttg
tgtgaccctttgcccagccctgagctgcccccgacagccactcgcgtctgttttctttag
ATAAACTGTTCTACATCTACACATCCGGCACCACAGGGCTGCCCAAGGCCGCCATCGTGG
TGCACAGCAG
gtaaggggcaggtgcccagggtggggtaggcacaggcagggctggggagcctccttctgc
ctttctagggcccgctcagcccttggccctgtgccttcccaggtattaccgcatggctgc
cctggtgtactatggattccgcatgcggcccaacgacatcgtctatgactgcctccccct
EXON 5  92 bp
ttctttagataaactgttctacatctacacatccggcaccacagggctgcccaaggccgc
catcgtggtgcacagcaggtaaggggcaggtgcccagggtggggtaggcacaggcagggc
tggggagcctccttctgcctttctagggcccgctcagcccttggccctgtgccttcccag
GTATTACCGCATGGCTGCCCTGGTGTACTATGGATTCCGCATGCGGCCCAACGACATCGT
CTATGACTGCCTCCCCCTCTACCACTCAGCAG
gtaactctagggctgtcacacagcctccagcacctgccaggtctctaggaaccccacccc
catcaggcagtgtgctgcagtagaaacacacagctttgggccaggcgcagtgactcacac
ctgtaatcccagcactttgggaggccaaggtgggcggatcacttgaggccaggagttcga
EXON 6  110 bp
gagcctggtgatggaagccggggaggcttcttggaggaggtcacccaaggcaggcagatg
tgaggtgcagaagcctgcagggcagcacaagcctgcctggctggatggcagtatcactga
tttggggccggggagggtcttcatctcgctgaccctcaggggccatccctctgcctccag
GAAACATCGTGGGAATCGGCCAGTGCCTGCTGCATGGCATGACGGTGGTGATTCGGAAGA
AGTTCTCAGCCTCCCGGTTCTGGGACGATTGTATCAAGTACAACTGCACG
gtgagcgagagcgggaagggtgagctgtccctttcccctagttaccctcttcccaactac
actccggggcatctgtcttatagctgaggtggccagtcattccaaagggctcatttgtgg
caaagttcccattgttcagatgggaaggctgagacccggagagggaaaggatggcatggc
EXON 7  210 bp
cattccaaagggctcatttgtggcaaagttcccattgttcagatgggaaggctgagaccc
ggagagggaaaggatggcatggccagcccctggggagagtaggggcttgagggatcagga
gaatcctagtgtagtgagggcagcctctggagcctcgaatcacaccaagttcacccccag
ATTGTGCAGTACATTGGTGAACTGTGCCGCTACCTCCTGAACCAGCCACCGCGGGAGGCA
GAAAACCAGCACCAGGTTCGCATGGCACTAGGCAATGGCCTCCGGCAGTCCATCTGGACC
AACTTTTCCAGCCGCTTCCACATACCCCAGGTGGCTGAGTTCTACGGGGCCACAGAGTGC
AACTGTAGCCTGGGCAACTTCGACAGCCAG
gtgcggccaggttggggatgggcgaggctgctgcagggatggcccacagaaggcactgga
tgcagaggggagggcagagttcgagcgtgagagtgtgggtgctggagtcccacttccccc
tcattgtccagttttgggcccatggtgagagagcccaggcccaagtcttggccttcgcag
EXON 8  127 bp
gtgcggccaggttggggatgggcgaggctgctgcagggatggcccacagaaggcactgga
tgcagaggggagggcagagttcgagcgtgagagtgtgggtgctggagtcccacttccccc
tcattgtccagttttgggcccatggtgagagagcccaggcccaagtcttggccttcgcag
GTGGGGGCCTGTGGTTTCAATAGCCGCATCCTGTCCTTCGTGTACCCCATCCGGTTGGTA
CGTGTCAACGAGGACACCATGGAGCTGATCCGGGGGCCCGACGGCGTCTGCATTCCCTGC
CAGCCAG
gtctgccacttcggggtcagagagggaggggttggcctgggaaggaaggaggccaggcgc
gtgtggatggggagccttgttctgaccagtggccatcagttatctctgctcttagggtta
caagttactcatttatttgtgtatccatccattcattcattcattcgccattctatctgt
EXON 9  138 bp
aacccaggaggtagaggttgcagtaagccaagattgcactgctgcactccagcctgggca
acaagagcaaaactccgtctcaaaaaaaaaaaaaaaaaaaaagacgcagggtacacctgg
tgacaggacgggtgggagaggctgcctagggcagatctgaccctgccttccccaccccag
GTGAGCCGGGCCAGCTGGTGGGCCGCATCATCCAGAAAGACCCCCTGCGCCGCTTCGATG
GCTACCTCAACCAGGGCGCCAACAACAAGAAGATTGCCAAGGATGTCTTCAAGAAGGGGG
ACCAGGCCTACCTTACTG
gtgggtccccagcccttcacagccccttcctgagggttgggggaggaggggaccttctcc
cacctccagaggacaccttcccaggactcccccagtcctggcccttgtggtcaaacaaat
ccttgggctccagcaaagcctccctggcttgagccctggtctcagagctggccaggccca
EXON 10  165 bp
tcctgagggttgggggaggaggggaccttctcccacctccagaggacaccttcccaggac
tcccccagtcctggcccttgtggtcaaacaaatccttgggctccagcaaagcctccctgg
cttgagccctggtctcagagctggccaggcccagccctgcctcatccggcccctccctag
GTGATGTGCTGGTGATGGACGAGCTGGGCTACCTGTACTTCCGAGACCGCACTGGGGACA
CGTTCCGCTGGAAAGGTGAGAACGTGTCCACCACCGAGGTGGAAGGCACACTCAGCCGCC
TGCTGGACATGGCTGACGTGGCCGTGTATGGTGTCGAGGTGCCAG
gtatgtgcaggcaggcgcgaggtgtgggtagggaggcaccacccaggggcaccaccagct
actcagtgtctaccctgccacccccaggaaccgagggccgggccggaatggctgctgtgg
ccagccccactggcaactgtgacctggagcgctttgctcaggtcttggagaaggaactgc
EXON 11  147 bp
aaggtgagaacgtgtccaccaccgaggtggaaggcacactcagccgcctgctggacatgg
ctgacgtggccgtgtatggtgtcgaggtgccaggtatgtgcaggcaggcgcgaggtgtgg
gtagggaggcaccacccaggggcaccaccagctactcagtgtctaccctgccacccccag
GAACCGAGGGCCGGGCCGGAATGGCTGCTGTGGCCAGCCCCACTGGCAACTGTGACCTGG
AGCGCTTTGCTCAGGTCTTGGAGAAGGAACTGCCCCTGTATGCGCGCCCCATCTTCCTGC
GCCTCCTGCCTGAGCTGCACAAAACAG
gtgtgtccctcccctgctccagctctcggatcccaggtcccttcccgtttccttctggag
agacccggttggctgttacttgacctctgcacacagcctggccgggcagttggtaaagtg
acctgcctgtgtagaggtgagcagacggggctggcagagaagacacacattgttccttag
EXON 12  158 bp
actttgccacagctgctgtatgaccattctttgcaaactgtaaagggctgtgcctcctcc
cccacttccctcccctgtttgtcctccagccctgctccctgccttcctcagtactggtgg
ttgggaagctgggagctcgggcccctgccctgcactgagtcttcttccctgctctcccag
GAACCTACAAGTTCCAGAAGACAGAGCTACGGAAGGAGGGCTTTGACCCGGCTATTGTGA
AAGACCCGCTGTTCTATCTAGATGCCCAGAAGGGCCGCTACGTCCCGCTGGACCAAGAGG
CCTACAGCCGCATCCAGGCAGGCGAGGAGAAGCTGTGA
ttccccccatccctctgagggccggcggatgctggatccggagccccaggttccgcccca
gagcggtcctggacaaggccagaccaaagcaagcagggcctggcacctccatcctgaggt
gctgcccctccatccaaaactgccaagtgactcattgccttcccaacccttccagaggct