Gene OR2K2 Variant 1
DNA : 2.37 KbNT_008470
mRNA : 1017 bp XM_095961
CDS : 1017 bp XP_095961
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  17 bp
ttctttgaagtaatgttttataataatctaataaattttttattattagagaaatctatt
aaatataaaatttggcagagaaattcataagatgaaagcaatttttaagaacatgtatat
atgaaaataggaaagactcagtggagaaagaaaacggttgaaggtttattaaaaggcaat
ATGAGTGCAGAAGCAAG
gtaagttttttgtaataattttttgttaataatgtgaaatgtaaggaaaaaatatacaac
tttaagtttctgactgtcctgctagaaactagttttgccctgcagcgacccctctgtggg
aatctcattgatcacaagtgaaattctggaagtgctaaagttagtttgctcaagttcact
EXON 2  1000 bp
taaattttgttgtggaagaatcaacttatgtacatcaacctgctcccccccttacatcaa
taaacacactatcctgtgatttcttgtagtaaaattgcatttataatagtgaaaataagt
ttgagagtattttcctaactaaatgaatatcacactttattcatttctttatgtcctcag
ATTAAATGAAGGGAATAGTACTGGAAGAAATATAGATGAAAGAAAGAAAATGCAAGGAGA
AAACTTCACCATTTGGAGCATTTTTTTCTTGGAGGGATTTTCCCAGTACCCAGGGTTAGA
AGTGGTTCTCTTCGTCTTCAGCCTTGTAATGTATCTGACAACGCTCTTGGGCAACAGCAC
TCTTATTTTGATCACTATCCTAGATTCACGCCTTAAAACCCCCATGTACTTATTCCTTGG
AAATCTCTCTTTCATGGATATTTGTTACACATCTGCCTCTGTTCCTACTTTGCTGGTGAA
CTTGCTGTCATCCCAGAAAACCATTATCTTTTCTGGGTGTGCTGTACAGATGTATCTGTC
CCTTGCCATGGGCTCCACAGAGTGTGTGCTCCTGGCCGTGATGGCATATGACCGTTATGT
GGCCATTTGTAACCCGCTGAGATACTCCATCATCATGAACAGGTGCGTCTGTGCACGGAT
GGCTACGGTCTCCTGGGTGACGGGTTGCCTGACCGCTCTGCTGGAAACCAGTTTTGCCCT
GCAGATACCCCTCTGTGGGAATCTCATCGATCACTTCACGTGTGAAATTCTGGCGGTGCT
AAAGTTAGCTTGCACAAGTTCACTGCTCATGAACACCATCATGCTGGTGGTCAGCATTCT
CCTCTTGCCAATTCCAATGCTCTTAGTTTGCATCTCTTACATCTTCATCCTTTCCACTAT
TCTGAGAATCACCTCAGCAGAGGGAAGAAACAAGGCTTTTTCTACCTGTGGTGCCCATTT
GACTGTGGTGATTTTGTATTATGGGGCTGCCCTCTCTATGTACCTAAAGCCTTCTTCATC
AAATGCACAAAAAATAGACAAAATCATCTCGTTGCTTTACGGAGTGCTTACCCCTATGTT
GAACCCCATAATTTACAGTTTAAGAAACAAGGAAGTCAAAGATGCTATGAAGAAATTGCT
GGGCAAAATAACATTGCATCAAACACACGAACATCTCTGA
ttgggtccctatggttttaccagagatgtgcccctggcagagctcatcagagaaattcga
gacaacatacaacctcttagaactctgatcggatcttatctctatataatttcacagtta
tgagctgcatacacagagtgattgcctattaataatagtaggtttcaatttgcatttgtt