Gene NOXA1 Variant 1
DNA : 10.99 KbNT_078083
mRNA : 1591 bp XM_351868
CDS : 1431 bp XP_351869
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  292 bp
ccgggcgcacaaagctcccggcggaagtccggccggggcgggggccgaatgggaggtggg
cgaggcctgagggtctggagtgggcgtagccgtttctggcgggggcgtggccttaccggg
gaggggcgggcgcctgccgccagggggcgccgcggggcagcggggttgcacctggcgctt
GGCGCCCGCACCTCTGCCCGCCTCGGAGACCCCGCAGCCCCGCGCCGCCGCCTGGCCCCG
GCCCCGGCCCCTCCGCGGGATCCTGGCCCCTCCTCGAGCGCCGCCACCGGCCGCCATGGC
CTCTCTGGGGGACCTGGTGCGCGCCTGGCACCTGGGCGCGCAGGCTGTGGATCGTGGGGA
CTGGGCCCGCGCCTTGCACCTCTTCTCGGGCGTCCCGGCGCCGCCCGCCAGGCTGTGCTT
CAACGCGGGCTGCGTGCACCTGCTGGCCGGGGACCCCGAGGCCGCGCTGCGG
gtgagcggggcgtggggaggccggtgcgggcgacgcctccgcctcgagcccctggggagg
gcccagcgcccctccccgaccgtcacggggtcgccctgccgcccccgacccagcgaacgc
cccggcaggtgggagccgagcaggggggccgcacctgagctaagcgaggccgcgctgggg
EXON 2  83 bp
agtggcgacagccctgcccaggcaggggctccgaaggttcctggacaggagcaggagggg
ctgtggggggtccccaggggctgacggaattccgtggccctgtcacccatcacgctgtat
ctgtgatgctgcgtgaccaggttacagaccttggcatcccgtgggcatttttgtccccag
GCATTTGACCAAGCCGTGACCAAGGACACCTGCATGGCGGTTGGCTTCTTCCAGCGAGGA
GTGGCCAACTTCCAGCTGGCAAG
gtgagtacaggggtgccttgttccttctctgacggccctttgtctccctgcagagtccac
tcctgcacctcctcctcctccctctccatccactccctcctcttgcccaccccctcctcc
atggttcctggctccagggaaacctgagactgtggccctcgcctctgctgagcgccaccc
EXON 3  109 bp
atgtgcatggacccctggcccaccagacctgagtgtgcagacctaggcaccgcactgccc
tccctcaggtctccttggaaccaggtgttgggggcggctcgagcggggctggtgtgaaag
ctgcctaaccacagccccatctccgccctgtgctgctgaggggaccccggctgcccacag
GTTCCAGGAGGCTCTGTCTGACTTCTGGCTGGCCCTGGAGCAGCTGAGGGGCCACGCTGC
CATCGACTACACGCAGCTGGGCCTGCGGTTCAAGCTGCAAGCCTGGGAG
gtgaggccgggcagggctcactgtgctgctggctgtggggtgtccacgggcggtggcact
gtcacaggagggccctgtggactggggagcgcctctggccgaagctcttggtgccatgga
ataccctggccactccttgacccgcaggaggttctggtggcagtggaggtggagggacca
EXON 4  135 bp
ggggagaagccaggtggggggactgggggagaggctgggtggggggatgggggaggggcc
aggtggggggactgggggaggggctgggtgggcagaccgagggaggagctgggtggggga
accgggagagggcctgggtggggcatcaggcccctgccatcaccttggccccactcccag
GTGCTACACAATGTGGCGTCGGCACAGTGCCAGCTGGGGCTCTGGACAGAGGCGGCCAGC
AGCCTAAGGGAGGCCATGTCCAAGTGGCCGGAGGGGTCCCTGAATGGCCTGGACTCAGCC
CTGGACCAAGTGCAG
gtgaggagtgccagcccggtcatggttttgggctggtgcctaccaaagctcctcaagacc
aatttcatgagatgaagaagcttccggagggagatggccctagtgcccagtttcgggtgc
caggcgggggcttcctgtgacctgcgggaagggggtggggggcccaagcggccccttctg
EXON 5  108 bp
gcttccggagggagatggccctagtgcccagtttcgggtgccaggcgggggcttcctgtg
acctgcgggaagggggtggggggcccaagcggccccttctgctccaaggcacaggggctc
tgcggctgcaggcctggttggtcaccccgtctgcatctgctggatacccaccccctccag
AGACGGGGCTCACTGCCGCCACGGCAGGTCCCCAGGGGCGAGGTCTTCCGGCCCCACCGG
TGGCACCTGAAGCACTTGGAGCCCGTGGATTTCCTGGGCAAGGCCAAG
gtaaaggtggggacggcgtcctggggcatggcggctggtgctgagccctcgaactgtgtt
cccagggatggggggaggtgcagtccaggccaccgtaagggccaggagggtagagagtgg
gcccacagccatcctcaaactggcgcccacggtaggggggcggtgccccaaatggggctg
EXON 6  60 bp
gatgtttttctccatcagacatttccctccatggtggtctggcagacgtgggccgggcat
gggcagctgtcacccagcccccggggacttagagctgcggggcacggtggggcgggctgc
agggagcagaccctgctgggccgctgatccctgacccagcgtccccactgtccccgccag
GTGGTGGCCTCTGCCATCCCCGACGACCAGGGCTGGGGCGTCCGCCCTCAGCAGCCACAG

gtgggtttgcggcccctcagacccctgcctggcctcacccagctttctgggaaagaaaat
gctgcacaagctctgagccctcctggggctgcgaagttcctctgatgggaggtgtggggt
ggccatcccatccctgtgtaagacctggggaaaccactcttcaaggttcaggaggaggga
EXON 7  26 bp
aaagaaaatgctgcacaagctctgagccctcctggggctgcgaagttcctctgatgggag
gtgtggggtggccatcccatccctgtgtaagacctggggaaaccactcttcaaggttcag
gaggagggagggcggcccccgacccttaaccagagcgaggttgttgctttgtgtccacag
GGACCAGGAGCGAACCATGATGCCAG
gtaggaggggctgactgggccctgcgagcgcgtgcctttcctgctgggcagaggccctcc
acatggggccacgcgggccgggcacaggagggcagtcagatgggcagggcctgagagcct
ccctcctctccctaggtccctaatcatggactccccaagagctggcacccaccagggccc
EXON 8  106 bp
tgttgctttgtgtccacagggaccaggagcgaaccatgatgccaggtaggaggggctgac
tgggccctgcgagcgcgtgcctttcctgctgggcagaggccctccacatggggccacgcg
ggccgggcacaggagggcagtcagatgggcagggcctgagagcctccctcctctccctag
GTCCCTAATCATGGACTCCCCAAGAGCTGGCACCCACCAGGGCCCCCTCGATGCAGAGAC
AGAGGTCGGTGCTGACCGCTGCACGTCGACTGCCTACCAGGAGCAG
gtgcgtgggcctgggcctcttcccctgctgggggtcggtgcttctgctgcctccgcagac
tggggaccacaatgggaccaacatgagggtggagggagcagctcgctggggggtagacgg
ggccgggctcacccgtggtcctggcccagcccagccagatgggaggatgcctggctgtgc
EXON 9  46 bp
acccagccccatcctaaggcagccgacttgtggccagtgccctgaattcaacacccacag
accacctgctgggtgctggccgggcacacaggccacacccttggtgtgggctctgcgagg
acagtaccggcctccagcacctgaccgccccagcccacccagcctgtgcttctcttgcag
AGGCCCCAGGTGGAGCAAGTTGGCAAACAGGCTCCTCTCTCCCCAG
gtatgggcgtcctcagcggcggggtccccgggtgaaggaggaagctgctggtgcatgggt
gccggctgccctccacccacagggcccactttggtggtagtggctgtgtcagtcttgctc
tgtcctacagggctgccggcaatgggggggcctggccccggcccctgtgaggaccccgcg
EXON 10  59 bp
gcagaggccccaggtggagcaagttggcaaacaggctcctctctccccaggtatgggcgt
cctcagcggcggggtccccgggtgaaggaggaagctgctggtgcatgggtgccggctgcc
ctccacccacagggcccactttggtggtagtggctgtgtcagtcttgctctgtcctacag
GGCTGCCGGCAATGGGGGGGCCTGGCCCCGGCCCCTGTGAGGACCCCGCGGGTGCTGGG
gtaagaggctctagacccttcacctgtcagtcacctgagggaggctgaggccaagcccca
tccctcagaatcaaggcttgcaagcccccctcacctgcccagtctctgtccacacccctc
gggctgaagacggccctgaccaggccctgggcctcagcgaccacccctccccctcctgcc
EXON 11  155 bp
tctagacccttcacctgtcagtcacctgagggaggctgaggccaagccccatccctcaga
atcaaggcttgcaagcccccctcacctgcccagtctctgtccacacccctcgggctgaag
acggccctgaccaggccctgggcctcagcgaccacccctccccctcctgcctggacccag
GGAGCAGGTGCAGGGGGCTCCGAGCCCCTGGTGACTGTCACCGTGCAGTGCGCCTTCACA
GTGGCCCTGAGGGCACGAAGAGGAGCCGACCTGTCCAGCCTGCGGGCACTGCTGGGCCAA
GCCCTCCCTCACCAGGCCCAGCTTGGGCAACTCAG
gtgggccagaaagcccccggtggctgcggtggagctgggcaccgccccgactgaggcagc
tgctggaagagggggtggcagaggtcactgccctccctgcaggccccacccaggaggccc
cctctgaggaatctctttgcagttacctagccccaggtgaggacgggcactgggtcccca
EXON 12  115 bp
caagccctccctcaccaggcccagcttgggcaactcaggtgggccagaaagcccccggtg
gctgcggtggagctgggcaccgccccgactgaggcagctgctggaagagggggtggcaga
ggtcactgccctccctgcaggccccacccaggaggccccctctgaggaatctctttgcag
TTACCTAGCCCCAGGTGAGGACGGGCACTGGGTCCCCATCCCCGAGGAGGAGTCGCTGCA
GAGGGCCTGGCAGGACGCAGCTGCCTGCCCCAGGGGGCTGCAGCTGCAGTGCAGG
gtgagccaagggcgaggcaggggcaggggcaccctgaggggcggtggaggcccctcctcc
cagtgcccggcccgacctgcagcccactctcctgcctcagggagccgggggtcggccggt
cctctaccaggtggtggcccagcacagctactccgcccaggggccagaggacctgggctt
EXON 13  115 bp
ccatccccgaggaggagtcgctgcagagggcctggcaggacgcagctgcctgccccaggg
ggctgcagctgcagtgcagggtgagccaagggcgaggcaggggcaggggcaccctgaggg
gcggtggaggcccctcctcccagtgcccggcccgacctgcagcccactctcctgcctcag
GGAGCCGGGGGTCGGCCGGTCCTCTACCAGGTGGTGGCCCAGCACAGCTACTCCGCCCAG
GGGCCAGAGGACCTGGGCTTCCGACAGGGGGACACGGTGGACGTCCTGTGTGAAG
gtagggtgggcatggcccttcccaggcagcaccgtggtgcccggggtgtggggggcttag
agctcggcctgtgctgtgagcagacgtggcacccagaggccacgcctgggtaacgccctg
cagagcccgatgtcccccttgcagtggaccaggcatggctggagggccactgtgacggcc
EXON 14  182 bp
tccgacagggggacacggtggacgtcctgtgtgaaggtagggtgggcatggcccttccca
ggcagcaccgtggtgcccggggtgtggggggcttagagctcggcctgtgctgtgagcaga
cgtggcacccagaggccacgcctgggtaacgccctgcagagcccgatgtcccccttgcag
TGGACCAGGCATGGCTGGAGGGCCACTGTGACGGCCGCATCGGCATCTTCCCCAAGTGCT
TCGTGGTCCCCGCCGGCCCTCGGATGTCAGGAGCCCCCGGCCGCCTGCCCCGATCCCAGC
AGGGAGATCAGCCCTAATGATGCTGTGTCCATGATGCTTTTAATAAAAACAACCCCCACT
GC
agtctcaccctccaagtgggtgtgggaggccgggctggcccagcagaagcccccaggcct
ggactccatccatctgctcagacaacagcagggagagcgggggtccaggtggggcagctc
cctcccttccacccctctccgcccctcctgaggccccatcaggagcaggacccctgtgcc