Gene KIAA2026 Variant 1
DNA : 88.08 KbNT_008413
mRNA : 6462 bp XM_088551
CDS : 6462 bp XP_088551
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  566 bp
cgcaccgagccgagccggcggctgaggagagccaggcccgatgtggcgggggctacgcgc
cgcggccgagccgtgaggaagcggctcgcgctcacgcgtcccccagcacctcgagcggct
gttccacaccgcccagcctaggcctgccggggcatgagtgtgcccgggacgccgggagcg
ATGGAGCCGGCTGGGGAGGAAGAGCGGCCGCCACCGGCGGCCGAAGGAGAGGACGACGAG
GAGGAGGTGGCAGCGGCGGCCCAGACCTCAGGGCCGGCCCACGGAAGGAGTGCCTCCTCG
CTGGAGGACGCGGACGATCAGGAGGAAGAGATGGAGGCGATGGTGATCGGAGGCGGTTGC
TGCAAGGAGCAGGAGCTGACCTACGAGCTACAGCAGGGCTACCGCATCCTGGGCGAGTTC
CTGCAGGAGAAGCACCGGGGCCTCACCGCCCCCTTTCTGCAGCCCTTGGGGGGCGTTGCC
ACCGCGGAGGAGGAGGTGGCGGAAGGGCCGCGCAGCGGGGGCCGGGGCGGTCGCGCCTTC
CCGCAGCAGCCCGGACAGGGCATGTGTCTGCTGCAGATGGAAGAGAAGTTCGCCAGCGGC
CAGTACGGGGGCATCACCGAGTTCGTGGCGGACTTCAGGTTGATGCTGGAGACGTGCTAC
CGCCTGCACGGAGTGGACCACTGGATCTCCAAACAGGGCCAGAAGCTGGAGATGATGCTG
GAGCAGAAGTTAGCGCTTCTCTCTCG
gtaagcgagcccggtccccggtgggactgacagactgacacaaacacacactcacacgtg
cccgaggatgggctgggccaggggcctgggggcggcgctgataggtgctgagtcggtgct
ggagaagcccgggaggaggagcggcgctgggcggggaccggaggggtgtggtgggtgtgg
EXON 2  201 bp
ttatgacataaggagtatgagaaattgtgtagggaggataaaaagttagaacaaagctaa
gtaagtaaggtttaaatacttttatgtatttagcaaaagggattcttaagttgctggcta
agggggtttattgcttatccagaagatttgaccttgtgaattgacttattcttctccaag
GCACTTGAGAGAAAAGACAACGATAGCAGTTACATCTAGAGGCTATTATGGATTGGAGGA
TGAGAAGGGAACTGCATGTACCTCAACAAGGCGTCGGTCAACACCGCGAAGTTTGGCAGG
CTTGACAAGTGGAGTTTTTGAATCTATAATGGTTCAAGTTTTGAGACAGGAAGAACAGCT
GAGAGCAAAAGAAGAAAAAAG
gtaaatgttaagaaaaaaattcataatttcagctgcataatttttatgtgcccatatcag
atttctgggcccattttagtagtgttctaaaatgcattgttacaaaagtatgaattcata
atgaaatatcgcaataaaatttgtttaaaatgtaattttaaaatttaaaaccacttatct
EXON 3  50 bp
tgttaatgctggtcagaggcaatttataatattttgttgctcttcttgtaataataaatg
taacttgctttgaaatttgtaggattgaaactcagccttgagactttctaccatcatact
ttttccagcagtaattaatttggaaacctgctgtaaagtattttttttttccttgtgcag
AGCTTCACAGAACTACTCCTACTATAGGAAAGGAGGGCTTATGGAAAGGG
gtaaagattaacttgacagtagcgtacagtagattggaatggggagaattgaagaaaagg
aaggcttgtacgaagaaggctgtagtagtctacatctccactactggtcaccacctccaa
tactggtcaccagaaattggaagaaatcagattgtcctgagaacaattaatagaacttag
EXON 4  127 bp
ccttcctcacatctctttagtattcatagtctgaggctagattccataatcctcccctga
aaggtacagtgtatgaggaacagcagcagtgtgagtagcagcccttgattagcttcagat
agtgcacacagatggcattatcacacttcaactgtgtcatgaattttcttcctcttctag
GAGCAAGTCAGTTGGTGCTAACTTTGGCCTACCAGGCAAACTGTGTTTCTGTCTCTTATA
CTGACCTGCTAGGAAAACCTGGGGGAAGTTATTTCACCTTTCTGTATGTCCTTAATATTC
GCAGCAG
gtaaataatttgtgaaattaccttatcaccaatctttatattggccaaaagttgcttttc
actgctttaggcaaagcaagtccataaaagttttttcatctactccaactttccctttca
ttttcttccccaagcactagctgtcactctttcacttctgcagaacatgtaacactcttc
EXON 5  1418 bp
agctgagattgcatcactgcactacagcctgggggacagagcgagactctgtctcaaata
aataaataaataaaactaggacagttgattgcctttttggctaaagataaatatacttaa
aatttatcattttatggtaccctctgaataataatagtataatttgttaaatttctttag
GCTTCGGGAGCAGGAAAGAAAAGAAGCAGAAGAAGCTAGTCAAAAGGAAATAGAAGAATG
GGAAAGAAAACTTCTAGCTCAAGCAGCTCCAACTTGTATGGAGACCATGTGGGAAATTCC
AGCTATTGGGCATTTCCTTTGTTTAGCTCAGCAAATTCTAAATTTGCCAGAAATAGTCTT
TTACGAATTGGAACGTTGTCTTCTGATGCCTCAGTGTAATGCTTTTCTATCGAAAATAAT
GACTTCTCTATTAAGTCCTCCCCATCGCAGACCTACCTTACATCGAAGACCTACTTTGCC
TTATAGGACCTGGGAAGCAGCGCTGAGGCAGAAAGTACAACAGTGGTACACTGCTGTAGG
GCAAACTGAAAATCCTGATAACTGTGCTGAAAAACTGGGGTTGTGTCCTCAGTTTTTTAA
AGTTCTTGGAGAAGTTAATCCATTGGAAGAAAAACCTTTTCACGAACTACCTTTTTACCA
AAAAGTGTGGCTACTTAAGGGTCTTTGTGACTTTGTGTATGAAACACAAAAGGAAGTTCA
AGATGCTGTACTTGGACAGCCTATCCATGAATGCAGGGAAGTTATTCTTGGTTATGATTA
TTTGGAGAATGCTTATGTACATTTTCCACAGTTCTGTGGTGCAGATGTACGGATTTATAA
ACAGAGACCCTTTCAGGCCCCAGAATTTCCAATTCCACCCATTAAAATACAAAGAGTACC
TCGGATTAAATTGGAGAAATTGAAGTGTGACTATGTTAGTACAAGTAATGGAGAACATAG
ATGTAGCAGAGATAGCCTGCCCTCTTCCTTCAAGAAAGAGCAGGAAAATAATTTTGATCC
AGCTTGCTGTCCTGCTAAAATGATCTTGGATAATCATGACATCTCTGTTGAAATGGGAGT
AAAATCCAACTATGAAATTAGAATTCGCAGGCCTTGTGAAATTAAAAAAACTGATTGTTG
TAAAGAAAATTTAGAGAAACCAAGGAGTCCAGGGGAAGTTACTGGCTTTGGAGAGCCTCT
TAGTCCAGGTGAAATAAGGTTTATAGAAAATCAGGAAAAATACGGTGAAGCTTCCAGAAT
AAAGATTGAACCCAGTCCATTAAAAGAAAATACTCTAAAATCTTGCCAAATACATGTAAA
TGGAAGTCACAGTGATCATCCAGAAATTAACTGCCACAAAGTTGTAAGGGATATTCTATT
AGAGCAGTCACTACAGAGCCACAAGAAACTCAAACTAACTAAAATGAGGGCAAAAAAGAA
GAAAAAGAAAAAAAAGAAATTGAAAGATGTTTTGAATGAAAACTTACAGAGAAAGCGTGA
AGGTCTTCATTCTCTTGCATTCAAGTCTTACAAACCTGAGATCCAGAATAAGTTATTGAT
CATCAAAAAAAAAGCAAAACACAAGAAGCACAAATCTG
gtaagctaacacaaatggatgggagttatatttaagtataattcaaattgttttttccat
tatgcatcatggatgctttgattgagagagtaaaatgcacatgtatgcatgcgtgtatat
ttgagggtcaaattttattttatattcaatgtgttaaaaagccagagcagatgacatttt
EXON 6  80 bp
ggtagttaatagtttaatgtttgcttttactggggcttgttttgattcatcatttttatt
tgactcactagcagccatctgttagttacaatttaactttcaaggatctgcgtaatttgt
tttttgttaatgaagtgctataaacagcattatgaaggttttctcttttaatcttgaaag
GAAAAAAATCCGTCTCTAAAAAAGCAATCACAAAGAAGAGGAAAACTGTCATAAAGTCAC
CTACTGTACCAGAGTTTCAG
gtaaatgtttcaactttgtctcgaaatttttcaattttttgtttcagtgttcatatcatt
cctcgagagtttggctgaattccaagaaactgtagcacacttacttgtaatgaaatgttt
ctgacagtgacttttctccctgcaagtgcagatgtaaccaagatttaatctgctagtatt
EXON 7  90 bp
gttcatacatcatagcaagtaaatatattttaaaatataaactgcagagcttttcttgct
ttttactattacagagaaaaataattgtgaattcagtgtgtgttaaaacaacttctgtta
ccacattttgggtgttttatattatgtgttatcaagctgtgtttttgtgttttattttag
CTTATTTGCACTAATCTTGATGAACTCAGGGAATTAATCACAAAAATCGAGAATGAACTC
AAAGATCTGGAAAACAGTAGAAAAAAATCG
gtaggtgttgatccaaaagttctatctattattgtcagcattaaaatttattcctgcttt
ttcctaaagcctttttgaaatcttgttttcctggattacatgaaaatttaccatgaaaga
tagaaacattgtttcttttatttctcctgtgtggtctagttttcatttttaatagacaga
EXON 8  116 bp
agaattgttacatatattgaataaaatttattacaggatattttccccctttctgcaagc
ttctgaagaagaaatacgtttttatggagtattggtgtttttgtattttactcagaaaat
aagttttgacatttacttttagaataaatctaagggatttactttaaacattatttttag
GGAAAATGGTATCATCGGAGGCAAGCTGTAAAAGAATTACATAGTACATTGATACGTCTT
TTAAATGAATTGCTGCCATGGGAACCAAAGTTAATGAAGGCTTTCCAAAGAAACAG
gtaattttaatgttataatctgttttacttattttatggtccttaatttacgatttttgg
atgatgtcctggaatcatttagtagttttccagtcatttgtaattcggcagatatttttg
actgcccactgtgtgcaaggctctttctaagccctgagaaaatattgttgactaaacaaa
EXON 9  188 bp
tctgtcttcctgagcattggcaagactgaactaagcatcttagacacacttaagattaaa
gcatttctagtgacttaataaaaaatatttccatatgtagtttaaaatgttaaaagttag
tttagattccaagaatttaaatcatatgtattatttattatgttgggcattttatttcag
GAGCCGCCTGAAGAAAGACTATGATGATTTCAGAAGACAACCTGATCATGATACATTTAA
TAGAGAACTATGGACCACTGATGAAGGTGAAGGAGATCTTGGAAAAGACTCTCCTAAGGG
AGAAATCAGTAAGTCTATAGACTCAACAGAACCTCTGGATATCCTGGAGAAAGATCACTT
TGATTCAG
gtaagcattaaactttttttttaagtcaacactgaaggcacaaagagaagtttttgtttg
ctgtgaaggcaaaagataatatggtcaatgaaatatattgattagggaaatctgttatgt
tttgaagaagtagtgtccacatccttataagaagtttctactagcctaggcaacatagcg
EXON 10  3626 bp
tcatgtcaaagatgaccttacctttgtcttcatcagtggtgctaaggcttttgaatcacc
ctgcagtagatttcttaatacactgccagctcaaagattgactttcttttttacagttga
tgttattactatttagttgctgttttatataaacaaaatgcccgtttttataattttcag
ATGATATGAAGTTGTCAGAAATAGATTTTCCTATGGCTAGAAGCAAGCTGTTGAAAAAGG
AATTGCCTTCAAAAGACTTACCGAAGACACTGCTTAAAACACTTAAACGACAGTCCAAAC
AAACTGATTATGTGGATGACAGCACAAAAGAGCTTTCTCCAAGGAAGAAGGCAAAGTTAA
GCACAAATGAGACAACAGTTGAGAATCTAGAAAGTGATGTGCAGATTGACTGTTTCAGTG
AATCAAAGCATACAGAGCCATCATTTCCAGAGTCATTTGCCTCATTGGATTCAGTACCAG
TGTCTACTCTCCAGAAAGGGACCAAACCCATTCAGGCTTTGCTTGCAAAGAATATTGGGA
ATAAAGTGACCTTAACAAATCAACTGCCTCCTTCCACAGGTAGAAATGCTCTTGCTGTGG
AAAAACCAGTTTTATCTCCTCCGGAAGCAAGCCCGATAAAGCCAGCATTGACCTGCCACA
CCAATACAAAAGGTCCTTTACAAATGGTATACAAAATGCCCTGTGGCCAGTGGTTGCCAA
TAGATCTTCAAAATAGCTCTGTAAAGATTCAGGTGCAGCCTATGGTGGATCCTAAAACAG
GAGAAAAAATCATGCAGCAAGTTCTTATTCTGCCTAAGAATTTTGTGATTCAGCATAAAG
AAGGAAAAGCAGTTGCAAAAGAAGTGCCACCACTTCAACAGAAAGGTACAGAACAACATT
GTTCATCTTTCCCACAGACAACAAATATAAATTCTTCTTTAGCATCAGTTTTTGTCAACT
CACCAGGAACTGTTTCTACCCAACTACCAAATACAGCTTTCAACAAAACAATTACACCTT
TATCAAATATAAGTAGTGCTAGACCACAGCCTTTGTCGCCTGTAACCTCTGTAAGTAACT
TATTAACACCATCAGTTAAGACTAGCCAGAGTGAGGCAGGAAAAGCCAAGAATGCAGTTT
CAGCAGCCACATTCTCCTTGCCCAGTGCTTCACCGACCATTTCCTCCACAGGTCAGCCTC
TGTCATCAACAACAACACTAAATGGGTCTACAAATCCTGGTAGTTCCTTCAACTGTTTTG
CACAACAGACTGCTGATTCTTCTGAAGCAAAGCAAGAGCTGAAAACTGTGTGCATAAGAG
ATTCACAGTCAATTCTTGTTAGGACACGAGGTGGGAACACTGGAGTTGTAAAAGTACAGA
CCAACCCAGATCAAAATTCACCCAATACTGTATCTTCAAGTTCAGTTTTCACTTTTGCTC
CTCAGCTGCAGGCATTTCTGGTGCCAAAATCAACAACTTCTTCCTCTGCTTTTTCACCTG
TAGCTGGAACAACTACTACATCTAGTCTTTCACCTTTTAGCCAAACACCAACTTCTGTTT
CCATTCCAGCTAGCTTTGCCCCATCCATGGGGAAAAATCTCAAACTTACATTAGGCCACA
CCACTGGCAGTGGTGATTTGGGCCACGTGATAGATAAAACTTCACACATGCCCTCTTCTC
CCTTGAAGTCCTCTATTTGTTCTAGTACTCTACTACCATCAACAACAAGTAGTTCGGTAA
GTGTAATTAGCATATCAGCAGCAAATTTTGGACAAAACAATGCAAATATTATTCATACTC
CAACTAAACAGCAACAAGTAGATTATATCACAAAAAGTTACCCTGTTACAAGGTCAGAAG
CAACAGCAGCAACAAATGGAGATGTAATCAGTGGGACTCCAGTTCAGAAACTTATGCTGG
TATCAGCTCCATCTATTCTTTCTTCTGGCAATGGAACTGCAATTAATATGACACCTGCGC
TGACATCTACAGGTGTTTCTGCCCAGAAATTAGTTTTTATTAATGCCCCAGTTCCTAGTG
GTACATCAACCCCAACTCTTGTTGCAGAATCATTAAAACAAACTCTTCCTCCTCCATTGC
ATAAAGCATATGTTAAGACTCCAGAGCAACCCCAAATAGTACTGATTCCGTCTACAGTGG
GCACACCAATAAAAATAAATTCATCACCAGCTGTGTCTCAGATAAAGGATGTGAAAATTG
GACTAAACATAGGTCAAGCAATTGTAAATACTTCAGGCACTGTGCCAGCTATACCATCAA
TTAACATATTACAAAATGTAACCCCAAAAGGAGAAGACAAAAGTAGCAAGGGCTATATTT
TGCCATTGTCAACAAGTGGTAATTCAGTTCCAGTAAGCTCAAATTTTGTGAGTCAGAATA
TTACCCCTGTTAATGAATCAGTGGTTTCTTCAGCAAGAGCAGTAAATGTGCTTTCAGTTA
CCGGAGCAAATTTATCTTTGGGTTCCTTTCCAGTGACCTCAGCCTCTGCTTCAGCTGGGG
CACAACCTCCTGTTTTAGTCAGTGGAAATGATACCTCTTCAAGAATTATGCCTATTTTGT
CAAATAGACTTTGCTCATCAAGTCTCGGAAACACTGTGGCTATATCAACTGTGAAAACAG
GACACCTTGCATCATCTGTTCTGATTTCAACTACACAACCAGTAGTGTCTCCTAAATGTT
TAACATCAGCTTTGCAAATTCCTGTTACGGTTGCCTTACCTACACCTGCGACTACATCCC
CTAAAATAATAAACACAGTTCCACATTCGGCAGCAGTACCAGGAGCCACACGTTCTGTAT
CTATTTCTAAAAGACAATCTCGGACTTCACTCCAGTTCCATTCACCAGGGATTTCAACTA
CAGTGCCAACAAATGTAAACACAAATAAACCTCAAACTGAATTGTCGTCCCTTTCAACAA
GTCCAGGTAAAATAACTAATACGTCCAATTTTGCTTCTCTGCCAAATCAGCAAGCTTTAG
TAAAAACCCCCAGTTACAGTTCTGCTCCAGGTGGCACTACCATTCACACGGCTTCGGCAC
CATCCAATGTAACTAGTCTAGTCGGGAGTCAGTTCAGTGAACCTTGTATTCAGCAAAAAA
TAGTCATCAATACCAGTACACCTTTGGCACCTGGTACTCAGATTATGATTAACGGAACCC
GGTTTATTGTTCCACCACAAGGTCTTGGAGCTGGCAGCCATGTTCTCCTTATATCTACTA
ATCCAAAATATGGAGCCCCCTTAGTTCTTAACAGTGGCCAAGGCATTCAATCTACACCAA
TAGATAACTCTGCCCAGAAGATCACACTAGCATCAAATAATTCCTTAAGTGGCCAACCTC
TACAACATCCTCTAAGAAGCCCTACAAAATTTATAAACTCTTTTGGGAATGCAAGTTCTA
TACCCACAGTACATACATCACCACAACTCATAAACACAACTGCTAAGGTTCCTGTTCCAC
CTCCTGTACCAACAGTATCACTGACTTCAGTAATTAAGTCTCCAGCTACTCTTTTGGCTA
AGACATCTTTGGTTTCTGCCATTTGCCCCAGTAATCCTCCACTGCCAAGTAGCACTTCAG
TGTTTCATTTGGACCCACCTGTCAAAAAATTGTTGGTTAGCCCAGAAGGAGCCATTTTGA
ATACCATAAATACTCCAGCATCTAAGGTTTCTTCACTCTCTCCATCTCTCTCTCAGATTG
TTGTATCTGCCAGTCGAAGTCCTGCGTCTGTCTTCCCTGCTTTTCAGTCGTCGGGCTTAG
AGAAGCCTGACAGAGCTGCATCTTGA
atttagactaaaagagccagtttttaaataatggggcattgttttgactcccataaaaat
tttcaatgtttattatactgttgaaagcatactatacattgtgtgtgtgtgtgtgtgtgt
gtgtgtgtgtgtgtgtgtgttttaatgtatcttttcattagcttgcaacaaggctttgtt