Gene INSL6 Variant 1
DNA : 21.75 KbNT_008413
mRNA : 703 bp NM_007179
CDS : 642 bp NP_009110
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  305 bp
ctgagacccctgagctggcgggaaagccttgacgcagccggcgcgcgccttcccttgaag
ttctggcgacgcccccacgcgctcggaattccgcagtgtttgtgcgcgccgctcggcctg
gcgcaggcgcagacagggagcagggtccggccgaccgccattgcacaacgcggaggacta
GCCTGGGGTCACAGGGATGCCGCGGCTCCTCCGCTTGTCCCTGCTGTGGCTTGGACTCCT
GCTGGTTCGGTTTTCTCGTGAACTGAGCGACATCAGCAGTGCCAGGAAGCTGTGCGGCAG
GTACTTGGTGAAAGAAATAGAAAAACTCTGCGGCCATGCCAACTGGAGCCAGTTCCGTTT
CGAGGAGGAAACCCCTTTCTCACGGTTGATTGCACAGGCCTCGGAGAAGGTCGAAGCCTA
CAGCCCATACCAGTTCGAAAGCCCGCAAACCGCTTCCCCGGCCCGGGGAAGAGGCACAAA
CCCAG
gtaaaaatcgaaaccgaaggcatgtttgttcacctctgtatatttcttattcctgcattt
gctctgccagaaggtgagcttccccaggaagtggaatttgtgcctagtacacagctcttt
aaaaaattgtaaaaaacagtgtattgaaaatatacaaaacttcaatgaagcgcttttttt
EXON 2  398 bp
aggaaaacactacacctactttagttaaatattgcttttgaataaccatactttccattc
tttatttaaaatgtgattacttgttttttaataattagctgattttactgttccaatatt
aaattttcatctaaaggaagattttaataaaggagcatttattttcttctctctcaacag
TGTCTACTTCTTGGGAAGAAGCAGTAAACAGTTGGGAAATGCAGTCACTACCTGAGTATA
AGGATAAAAAGGGATATTCACCCCTTGGTAAGACAAGAGAATTTTCTTCATCACATAATA
TCAATGTATATATTCATGAGAATGCAAAATTTCAGAAGAAACGTAGAAACAAAATTAAAA
CCTTAAGCAATTTGTTTTGGGGGCATCATCCCCAAAGAAAACGCAGAGGATATTCAGAAA
AGTGTTGTCTTACAGGATGTACAAAAGAAGAACTTAGCATTGCATGTCTTCCATATATTG
ATTTTAAAAGGCTAAAGGAAAAAAGATCATCACTTGTAACTAAGATATACTAACCATCTT
AGAATTTTTTCTAACCTAATAAAAGCTTAATACATTTA
tttaactctatttttttttgtaattgtgcatataagtgatatgatgtgaaaaatgtctga
atgtacttgcaagcacttgaccataccttatagtggtaataggtatcttagtattttctt
tggtgaccctgttgttttccttagttttcatacgctttttgaagatctggagatggtttg