Gene GALNT12 Variant 1
DNA : 41.39 KbNT_008470
mRNA : 1746 bp NM_024642
CDS : 1746 bp NP_078918
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  371 bp
ccctgccgaaatgagccaccccgggggctgcgcttgggctggcgcggggctggacggaaa
gggggcggcgcgcaggtggggcgggccgggggcggggcggcacggcggttccgggatccg
ggtcctggcctccaccgccgccttggggcgcgcagatcgctggctgcagttggcgggcgc
ATGTGGGGGCGCACGGCGCGGCGGCGCTGCCCGCGGGAACTGCGGCGCGGCCGGGAGGCG
CTGTTGGTGCTCCTGGCGCTACTGGCGTTGGCCGGGCTGGGCTCGGTGCTGCGGGCGCAG
CGTGGGGCCGGGGCCGGGGCTGCCGAGCCGGGACCCCCGCGCACCCCGCGCCCCGGGCGG
CGCGAGCCGGTCATGCCGCGGCCGCCGGTGCCGGCGAACGCGCTGGGCGCGCGGGGCGAG
GCGGTGCGGCTGCAGCTGCAGGGCGAGGAGCTGCGGCTGCAGGAGGAGAGCGTGCGGCTG
CACCAGATTAACATCTACCTCAGCGACCGCATCTCACTGCACCGCCGCCTGCCCGAGCGC
TGGAACCCGCT
gtgagtgcacagctctggggaggaagcccgccctcagagccccgggcctcagtttctcca
tcagagcagtggcagggcggggagctggggtctccaggatggcgcgtcttattgagtctt
tctccgaagacgatagtgtaagagctcacatgggggcggggaggcaagaaagtaaaaaag
EXON 2  170 bp
gttaggacctttcttggagtctgctggggctcctagtgccacaaggggagctctggaaga
tccttcagtggattatgtccccttccgcaggggaccatgacctatgtcccctttgtcact
ccatccccagtgccagcctgggctagatcctgagttcctgaagttccgctgtatttgcag
GTGCAAAGAGAAGAAATATGATTATGATAATTTGCCCAGGACATCTGTTATCATAGCATT
TTATAATGAAGCCTGGTCAACTCTCCTTCGGACAGTTTACAGTGTCCTTGAGACATCCCC
GGATATCCTGCTAGAAGAAGTGATCCTTGTAGATGACTACAGTGATAGAG
gtgagtcccggccagggctctgggaagagcctgtccttctgtagcagtgtctgggaggtg
agagtgggatgcaggagggctaaagtaggcccagtaaggatgggcttcctgtatcctcct
gtacccaaggaagacctcagggatagtagcccagaaacagtaggcgtgggaaactggaag
EXON 3  190 bp
cggagcacttccaaccttggttctgggtgaggtaaggatgtcccaggtggcagagcaaag
gaggctcctgtctatttcatcttctgtttgggacagggaggcccagaaggccccgggttg
ggatgaggcgctcctccgagattgtcacggtgacccctgttgctttgtttgcctccctag
AGCACCTGAAGGAGCGCTTGGCCAATGAGCTTTCGGGACTGCCCAAGGTGCGCCTGATCC
GCGCCAACAAGAGAGAGGGCCTGGTGCGAGCCCGGCTGCTGGGGGCGTCTGCGGCGAGGG
GCGATGTTCTGACCTTCCTGGACTGTCACTGTGAGTGCCACGAAGGGTGGCTGGAGCCGC
TGCTGCAGAG
gtacgtgagccgcccaccatgggagagacagcatgttacctggagtaggtagcatgagga
acagactcatcacgtcacttgagggttaacgggttgcctgggctcagctgcttctctgtc
actgggcaggagagcagtccctgcttagttcggctgttgagaccgttaaatgatttagtg
EXON 4  186 bp
gtggtcacctgccagggctctgacacggctgcagacacctggaataagagaagcaggtct
ttctcagatgttcctccctcttattggaaggaagacaagaattcacccttgaatttccca
attgtcttcctgctgcccgtctgcataggagagacggatggatgtcttgggtgctttcag
GATCCATGAAGAGGAGTCGGCAGTGGTGTGCCCGGTGATTGATGTGATCGACTGGAACAC
CTTCGAATACCTGGGGAACTCCGGGGAGCCCCAGATCGGCGGTTTCGACTGGAGGCTGGT
GTTCACGTGGCACACAGTTCCTGAGAGGGAGAGGATACGGATGCAATCCCCCGTCGATGT
CATCAG
gtcaggagctgacttctgggtgacttgttttttaagcatgcctcattgaatctggctgac
ctgtgagcggaggccctcgggaggaatggttagctgtcagcttaactacctcccctcttc
ccacttttttgcccagagtatttgtttatttttattaaacgtgtctgctacacatgtcaa
EXON 5  118 bp
gggaccgtagggtacatctatgcctccaggcccagcctagtgtggggcacagaggtgaag
gcgggatatgcttagagatgacagatgaacagatgaaagggctcgtggtgggaaggtagt
tggataactgtgatggttttctgctgtctacagtgaaataaggatatcatacttttttag
GTCTCCAACAATGGCTGGTGGGCTGTTTGCTGTGAGTAAGAAATATTTTGAATATCTGGG
GTCTTATGATACAGGAATGGAAGTTTGGGGAGGAGAAAACCTCGAATTTTCCTTTAGG
gtaagtatttcagtcttctctttggacatgttcttaactgattctctctttgggaacgat
gggatttgctgtaagagcctggtggaccctgaaagatgatgacacgcatatcctataaac
atgcttgctttcttgttttagctttttaaaaagtgtactttttctagatttggggccagc
EXON 6  177 bp
tctttacccacattctgtgtcatgagtgtgccgggtaggtggcctcctgcccgatggagg
ctgagcatcttggcagtgtccatcatgccttgcgtgtgcctggcctctttgctgcagata
ctatggacccgcagctcatcccctgctcaccacctggcctctccttttctctgtgtgcag
ATCTGGCAGTGTGGTGGGGTTCTGGAAACACACCCATGTTCCCATGTTGGCCATGTTTTC
CCCAAGCAAGCTCCCTACTCCCGCAACAAGGCTCTGGCCAACAGTGTTCGTGCAGCTGAA
GTATGGATGGATGAATTTAAAGAGCTCTACTACCATCGCAACCCCCGTGCCCGCTTG
gtgagttcctcggcccacctgcactccatctggcttcatctgaacaacagcagctaatcg
tggcttccccaacatagtcgatctggttccagaaatagagaataaattgggtgctcagat
acgagtaaggggagaatttattcctccatttataataattatatgcagtcaaatcttctt
EXON 7  132 bp
tagaagctagaattaggtgcaaggatgttttctatcctctgtgctccacacagggcctgg
catgcgacgaatgctccatcaaagctggctggtggttagtaagtgagcatcagtgaacac
aggggctttgaaaggaagcactaggacccatggggtctcactgttttgttgttttctcag
GAACCTTTTGGGGATGTGACAGAGAGGAAGCAGCTCCGGGACAAGCTCCAGTGTAAAGAC
TTCAAGTGGTTCTTGGAGACTGTGTATCCAGAACTGCATGTGCCTGAGGACAGGCCTGGC
TTCTTCGGGATG
gtgagtgagggtggtgggcccacggcaggcagggacttccctggcctctgggtctgctct
gcaaatcctgggcaagaaaggccacgtcatggggagcactggcttcctccactcccaccc
gcctgcccaccccccaccacctttttatccactgcccttctttctccctgtgagcgtctg
EXON 8  114 bp
cctgcagaacaaggaagcacttttaaagctagaaggtgctgtacagaaaagactcttacc
tttgcgtctagctcttgaagcaggctctcctctcatgccaggtaccctccccaagccttg
tgtggcatctgttagtgtctataaatctggactgaaatgccacatttatgttttatttag
CTCCAGAACAAAGGACTAACAGACTACTGCTTTGACTATAACCCTCCCGATGAAAACCAG
ATTGTGGGACACCAGGTCATTCTGTACCTCTGTCATGGGATGGGCCAGAATCAG
gtaggtatgagcctcaaaagaggagaaagctgtgtgttttgttaaaaaaattaaatagtt
gaatttttttcttgtaaaagtaatatttgggaaatataaaaagtagaagcctagggtggc
cagactcagagagaccactgttaaaattaaaatgtgttttcttcccatcattttttacac
EXON 9  147 bp
gtagcggttcactgagggctgtgggatgcggaggaacccatcacacaggctcgtgttggt
ggtgacgcaggtgcatgaccccacccatgctctcgtgatcccaggttcttgtccagcgat
ctttcctcttcccacatcagtggaaaatgttgtgttacatgttggctgccccatttttag
TTTTTCGAGTACACGTCCCAGAAAGAAATACGCTATAACACCCACCAGCCTGAGGGCTGC
ATTGCTGTGGAAGCAGGAATGGATACCCTTATCATGCATCTCTGCGAAGAAACTGCCCCA
GAGAATCAGAAGTTCATCTTGCAGGAG
gtaggtgaactctctccttccttcctgctgacagtccctgggctataagggagagtgtga
gagtcagacgttctctctggcatagtcctggtgaggatcagggatgtggccatgcatgga
caggagctctggaagacctggaacctcagtcccagtgagcctggggggcggtgatggcag
EXON 10  141 bp
gtacaagcctggtgctgtgtccccgggacagtcctgagttgctgcgttacacggaagaca
cttacccctcaataaatatttctgaaatggtaaaaatcagaccctgatctctttaaaaca
tgtctttaggaaaaagagacttttctgatgacttgcctgtcattctgttatcttttgtag
GATGGATCTTTATTTCACGAACAGTCCAAGAAATGTGTCCAGGCTGCGAGGAAGGAGTCG
AGTGACAGTTTCGTTCCACTCTTACGAGACTGCACCAACTCGGATCATCAGAAATGGTTC
TTCAAAGAGCGCATGTTATGA
agcctcgtgtatcaaggagcccatcgaaggagactgtggagccaggactctgcccaacaa
agacttagctaagcagtgaccagaacccaccaaaaactaggctgcattgctttgaagagg
caatcattttgccatttgtgaaagttgtgttggatttagtaaaaatgtgaataagctttg