Gene EDF1 Variant 2
DNA : 3.51 KbNT_024000
mRNA : 538 bp NM_153200
CDS : 420 bp NP_694880
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  106 bp
cttccctacgtcgccggcgcccggccacgacgtccctcagacgagccgaacgccgaatgg
ccccgagcacgggaagtgcccgccccccgcgtgcagccagccaatgggacgccgaaagcg
gggaggtgccgaggggacgtagcgtcgccgcgccaggtctctagcagctgccgctgagcc
GCCGGACGGACGCTCGTCTTCGCCCGCCATGGCCGAGAGCGACTGGGACACGGTGACGGT
GCTGCGCAAGAAGGGCCCTACGGCCGCCCAGGCCAAATCCAAGCAG
gtgctttgctgactgaggagcggccgggccgggcggggcggacgctgggccggggccacg
gaccgtggggcagggggctcggggaagggcaggcggggcctgggacagggcgcaggggac
ggggacaaggctggggtgccgggggcaggacggggttcgaagggcggggcgaatcgcagg
EXON 2  52 bp
tacaggcataagccatggtgcctagttgagcttaggtaactgaacccaggactgcatatc
agtccttgggcaccactagtccttagcagtgtgctaactggctaacagcaggcctgaatt
ggtgtgtgctggatactgtcaaagctaattttgatccactgatgttttctaattttctag
GCTATCTTAGCGGCACAGAGACGAGGAGAAGATGTGGAGACTTCCAAGAAAT
gtaggtacttgtgtttccgcttgcaacatgaggctgtgctgtggggtccatgtgctggtg
ggtgtggtgtgtgcggcgcccccggggacgttgtcagctgagtgcctgcctgcaccggtg
ctggccggagccctgggaggcagccatcttcccagagcagctctggttggcatgagtaca
EXON 3  161 bp
tcataactgagagaaaactctggaagtccacgacctgaggtgtgtgaacttgggacagcc
tgggttcccatgtccccttgagttcaggcagcctctggggtctggttaccgctttgaaat
ggtttttcttcaggttaattccaaatcctctcctctgcttttgcctcacaccgactccag
GGGCTGCTGGCCAGAACAAACAACATTCTATTACCAAGAACACGGCCAAGCTGGACCGGG
AGACAGAGGAGCTGCACCATGACAGGGTGACCCTGGAGGTGGGCAAGGTGATCCAGCAAG
GTCGGCAGAGCAAGGGGCTTACGCAGAAGGACCTGGCCACG
gtgaggctgcgccggggctctcactcctggggttgtgggtttggggagggggatggccgg
tgttcagatagcacggggagggtgggctccacccccctggttcccctgcagggaatgcct
cgggaagccaggtcagcccggctctcactgcctctcgcacaaaacccagctgcgtgtggg
EXON 4  219 bp
cagggaatgcctcgggaagccaggtcagcccggctctcactgcctctcgcacaaaaccca
gctgcgtgtgggtgcgtaccccaggggccctagaagctgctgttctcaggcgacgcttcg
cgcctggttttgcagcagtcctagtggagctgatgtgtataaagcacatcttctctttag
AAAATCAATGAGAAGCCACAGGTGATCGCGGACTATGAGAGCGGACGGGCCATACCCAAT
AACCAGGTGCTTGGCAAAATCGAGCGGGCCATTGGTGAGTGTCCCTCCACCCTTCGCCGG
GTCCGCTGAACAGGGAGGCTACCCGCTCCCAGCTGGGGTTGGTGAGAGTGGGACTCGGGG
GAAGAAGATGGCCCTGGGGGTCCCCTGTTCTCTGAATTC
tggagctttgcttctccaggtagtacagactgagggatggtggggtctctgcaggcctca
ggaaacccctaagagcaagtggagtccgagtcccttccccttgccagttcccgtcagcct
gtgctgttggcgatggttctctgagcctgagcacagcgggtccgggccctgtcagcatgg