Gene EDF1 Variant 1
DNA : 4.17 KbNT_024000
mRNA : 640 bp NM_003792
CDS : 447 bp NP_003783
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  106 bp
cttccctacgtcgccggcgcccggccacgacgtccctcagacgagccgaacgccgaatgg
ccccgagcacgggaagtgcccgccccccgcgtgcagccagccaatgggacgccgaaagcg
gggaggtgccgaggggacgtagcgtcgccgcgccaggtctctagcagctgccgctgagcc
GCCGGACGGACGCTCGTCTTCGCCCGCCATGGCCGAGAGCGACTGGGACACGGTGACGGT
GCTGCGCAAGAAGGGCCCTACGGCCGCCCAGGCCAAATCCAAGCAG
gtgctttgctgactgaggagcggccgggccgggcggggcggacgctgggccggggccacg
gaccgtggggcagggggctcggggaagggcaggcggggcctgggacagggcgcaggggac
ggggacaaggctggggtgccgggggcaggacggggttcgaagggcggggcgaatcgcagg
EXON 2  52 bp
tacaggcataagccatggtgcctagttgagcttaggtaactgaacccaggactgcatatc
agtccttgggcaccactagtccttagcagtgtgctaactggctaacagcaggcctgaatt
ggtgtgtgctggatactgtcaaagctaattttgatccactgatgttttctaattttctag
GCTATCTTAGCGGCACAGAGACGAGGAGAAGATGTGGAGACTTCCAAGAAAT
gtaggtacttgtgtttccgcttgcaacatgaggctgtgctgtggggtccatgtgctggtg
ggtgtggtgtgtgcggcgcccccggggacgttgtcagctgagtgcctgcctgcaccggtg
ctggccggagccctgggaggcagccatcttcccagagcagctctggttggcatgagtaca
EXON 3  161 bp
tcataactgagagaaaactctggaagtccacgacctgaggtgtgtgaacttgggacagcc
tgggttcccatgtccccttgagttcaggcagcctctggggtctggttaccgctttgaaat
ggtttttcttcaggttaattccaaatcctctcctctgcttttgcctcacaccgactccag
GGGCTGCTGGCCAGAACAAACAACATTCTATTACCAAGAACACGGCCAAGCTGGACCGGG
AGACAGAGGAGCTGCACCATGACAGGGTGACCCTGGAGGTGGGCAAGGTGATCCAGCAAG
GTCGGCAGAGCAAGGGGCTTACGCAGAAGGACCTGGCCACG
gtgaggctgcgccggggctctcactcctggggttgtgggtttggggagggggatggccgg
tgttcagatagcacggggagggtgggctccacccccctggttcccctgcagggaatgcct
cgggaagccaggtcagcccggctctcactgcctctcgcacaaaacccagctgcgtgtggg
EXON 4  94 bp
cagggaatgcctcgggaagccaggtcagcccggctctcactgcctctcgcacaaaaccca
gctgcgtgtgggtgcgtaccccaggggccctagaagctgctgttctcaggcgacgcttcg
cgcctggttttgcagcagtcctagtggagctgatgtgtataaagcacatcttctctttag
AAAATCAATGAGAAGCCACAGGTGATCGCGGACTATGAGAGCGGACGGGCCATACCCAAT
AACCAGGTGCTTGGCAAAATCGAGCGGGCCATTG
gtgagtgtccctccacccttcgccgggtccgctgaacagggaggctacccgctcccagct
ggggttggtgagagtgggactcgggggaagaagatggccctgggggtcccctgttctctg
aattctggagctttgcttctccaggtagtacagactgagggatggtggggtctctgcagg
EXON 5  227 bp
gtgatcagactcatcctcttcaaaattagatgtgggaaccaggagtgctcgtgtgctgag
agcccagtgaggcacgggagcggcgtggccccccttccctgggaagatgttgaagagggg
cagcgttggggggaggagggagctggtgctgcagtggccagtggctgtggctcatttcag
GCCTCAAGCTCCGGGGAAAGGACATTGGAAAGCCCATCGAGAAGGGGCCTAGGGCGAAAT
GAACACAAAGCCTCGAAATCAGTGCGCTCCAGCTGATCTCGTTCCGCCGGTTCCCCTTGG
CCGCCAGTTCCGTTCTCCTCACGGGCCGAACGGAACAAGGGGTCCAGCTTGCGGGGGACC
CTCCCCAGCCCATTCCTGCTGTCAAACAAACAAAACCTTGCAAAGCG
ctgggttctgctggctgtttttctccctacatcgcgttcctcagatcagggtgcagaact
ccaccttcctgtcctggggtgtctgcccagtagcggttgtggctcagaggcctcggggag
ctctgagcaccaccttatacaagggtgaggggtggaggcctgaggcgtggaaggaagagg