Gene ECM2 Variant 1
DNA : 40.65 KbNT_008476
mRNA : 3163 bp NM_001393
CDS : 2100 bp NP_001384
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  38 bp
cctggttactttcttggctgattttctgcacaaagaactgaaaggcatttatccccaagg
gaggcagttattttagattttactaagaagttcagcaaatacttttcaacattcccttct
gtcctttctttgtttttaaagaaagctctgattttgtttcattttcagctggagacttaa
ATGACACCAAGCAAAGCCTACTTAGTTTAGATCTCCAG
gtaaaaaagttttaaattttaagtttctacttagcatgtggaatggttttaatatttggg
tattttatttcacaactgtttaactcttgagtaaattagctcgttactaatagattttta
aagttcaaagtatgcattattctgtttgtttttttcacgatgtacttcccaagtatttca
EXON 2  319 bp
tgattctgatagaagaattccaaattatgatttggcaataatactatagcatatagtcca
tatatcataagtgtaatttctcaaagacttgcctactgaggcatacaagcaaatatataa
gccaattttcagaagtaaaaatttagtcaccactaactttgaaatattgtttcattctag
AAATTGGCTGGTGGAAAAAAATCAAACATGAAGATTGCAGTTTTGTTTTGTTTTTTTCTG
CTTATCATTTTTCAAACTGACTTTGGAAAAAATGAAGAAATTCCTAGGAAGCAAAGGAGG
AAGATCTACCACAGAAGGTTGAGGAAAAGTTCAACCTCACACAAGCACAGATCAAACAGA
CAGCTTGGAATTCAGCAAACAACAGTTTTTACACCAGTAGCAAGACTTCCTATTGTTAAC
TTTGATTATAGCATGGAGGAAAAGTTTGAATCCTTTTCAAGTTTTCCTGGAGTAGAATCA
AGTTATAATGTGTTACCAG
gtaagagaacactatgagagagagacagaaagagggaggagggtgagagatggtatgggg
aaagagaaggagagagggagagagggagaacatctccatgaagataattttctaaagaaa
aatccaggttattatattactttttggtttaatctacaaacatacattttaaaataattt
EXON 3  189 bp
ctgtgaaaagcatttcagcatttcttatgtctatacgacatctttaccctatacatgaat
gcacatagaattctattcttgtgtggttagagcagtttgacttcacattgtgtttacttc
cattcacagttactgataatcacataagaaatttaaatttgtgcttttgttttcttctag
GAAAGAAGGGACACTGTTTGGTAAAGGGCATAACCATGTACAACAAAGCTGTGTGGTCGC
CTGAGCCCTGCACTACCTGCCTCTGCTCAGATGGAAGAGTTCTTTGTGATGAAACCATGT
GCCATCCCCAGAGGTGCCCCCAAACAGTTATACCTGAAGGGGAATGCTGCCCGGTCTGCT
CCGCTACTG
gtacagagatttagctaagcaaaatatcagtgtgtgattaatctttaacttccatttgtt
tttgttactaattttagattaaaattatgatacattagtcagatctgagtacttaaaata
ttggcaaaatgctgattaacatagaaaatatctgggaaaatgtatggtaggggatataaa
EXON 4  573 bp
aatagaaataaagtgactattaaaactttttaagcaagaatttcaaggtgcatttcatct
ttaaattgcactcaaatacttggagggaataatatttactaacctcattttcattatggt
tttttcttttattaatatcatcaacttatctctgctacctcatccttgcgtggtcattag
TCTCCTATTCTCTACTCAGTGGTATAGCATTAAATGATAGAAATGAATTTTCTGGTGATT
CTTCAGAACAAAGAGAACCTACCAATTTACTTCATAAGCAACTGCCACCTCCTCAGGTGG
GAATGGACCGAATAGTAAGAAAAGAAGCACTTCAATCTGAGGAGGATGAAGAAGTGAAAG
AAGAAGATACAGAGCAAAAGAGAGAGACCCCTGAATCTAGAAATCAGGGGCAACTTTACA
GTGAGGGGGACAGCAGAGGAGGAGACAGAAAGCAGAGGCCTGGAGAGGAGAGGAGGCTGG
CACACCAGCAACAACGCCAAGGAAGGGAGGAGGAGGAGGATGAGGAGGAGGAGGGTGAGG
AGGGTGAGGAGGATGAGGAGGACGAGGAGGACCCGGTAAGAGGAGATATGTTCCGAATGC
CCTCTCGATCCCCGCTTCCTGCTCCTCCCAGAGGCACACTGCGCCTGCCAAGCGGGTGCT
CTCTGTCCTACAGGACCATCAGCTGCATCAACGCCATGCTTACCCAGATACCACCGCTGA
CAGCACCACAGATAACAAGTCTGGAGCTCACTG
gtaagagatgttgacttctgctttattttgtgctttaaaagtaaatgactcttagcagct
gggcacggtggctcacgcctataatctcagcactttgaaaggctgaggtggccagatcac
ctgaggtcaggggtttgagaccagcctggacaatatggtgaaaccccatctctaccaaaa
EXON 5  116 bp
ccagcttgttacttttctgaacatgctttggttatataatatatattctgtccttgttct
gagtattgctttctcctccagacaaagctctctcttgatatctatgcacacatgcccata
catgtgtgtacatgtatgtatatgcacacatgcctaaaacataaccgctgtgtgtcctag
GCAATTCCATCGCCTCCATCCCAGATGAAGCATTTAATGGATTACCAAATTTGGAAAGGC
TTGATCTGAGTAAAAATAATATCACTTCTTCAGGCATAGGTCCAAAAGCATTCAAG
gtaaatacatgctctgatttgtctatttggatgaatggcttcactatgacttgcattggt
tggagatggggaagggaggaaaaggaaaatgcttctaattggtagtcttcttctaagaaa
gtttcctctctgatgtccctaatttgaattcaagttttcccttgaatatagtttactatt
EXON 6  136 bp
attaccaggatcaatatcaacctggcagggggaataaggggtttgctgtgtggcctggac
attactgtctaagcctaaggaaggataggtttgtgagacttttagtcacgaccattatat
gaaatgtgactgcacagctgtgactagataaaaaagtaactttgagatttgctttttaag
CTTCTGAAGAAGTTAATGCGTTTGAATATGGATGGAAATAATTTGATACAGATTCCTTCA
CAATTGCCATCTACATTAGAAGAACTTAAAGTCAATGAGAACAATCTTCAGGCTATCGAT
GAAGAAAGTTTATCAG
gtatttaatatttgtttttcaatgatatgcttccttataatctttcctatatagtcctgt
agaaattttatttactgtattgccaaatgaataaatagtaaatatttttaggtcacttaa
ccatttgagttgataaaacttcttttaactattgactggtaaaacgtaaaatgaatttta
EXON 7  158 bp
tgagcatctgggatgtacaaagtacttaagaaaaggttttataggaggatacaaaggttt
aaaaaaaactgtatttgccctccaaataaaccggccatttcacatgacatttcaaaaggc
tacaaaaatttgcatggtttttcaattatcctaatattctaatacttttattttttatag
ACTTAAATCAGTTGGTCACCTTAGAATTGGAAGGAAACAATCTCAGTGAAGCCAATGTCA
ATCCTTTAGCTTTCAAACCTTTGAAGAGCCTAGCCTACTTGCGTCTGGGAAAAAATAAAT
TTAGAATTATACCGCAGGGTCTTCCTGGTTCTATTGAG
gtaacaatatatttttttagtgttttaaatgtattatatttgaaatatggtacactacaa
caaaatatattttaagactattgtgatgtaaattaaactctagtttcatgctgtatacag
aatttcctgtaatttaagcattgttttttcttcaagcaatacaaaattctgaatcgaaat
EXON 8  140 bp
ctgtctcaaaaaaaaaaaaaaaaaaaaagacaacttaaaaatatgagcttacttgaaaga
gcagtaagactctttagataatactaatgataatagtctatgtcactattttagtctcca
tgaaattgaacgtatcaactaacacaaaagaaaaataatagtcttctctcttaattatag
GAATTATACCTAGAAAATAACCAAATTGAAGAAATAACTGAAATTTGTTTCAATCATACC
AGAAAGATCAATGTCATTGTACTACGTTATAACAAAATTGAAGAAAATAGGATTGCTCCT
TTAGCCTGGATAAATCAAGA
gtaagtacatgctacaatttaaattttattgaactatttcttcctctcgctattattaaa
cagagtatggaaactgggaatgggataagtgagggaggtgacgatactgaagggctcgga
gacagaatcgtttcttagtgaacccttaccctatccccaaagtgggctacttcatgcagt
EXON 9  327 bp
gcagcttggtgcaagagactagggctggctatacctggaaaagttcctatttggaatcat
cactacaaactgggtgcttataggaaaatggaccagcatcgagactggccttatcaaaat
ttagagctgatgatcaccatcctgatgtccctaccctgtttacttttttctttgctgcag
AAATCTAGAATCCATTGATCTCTCCTACAACAAGCTCTATCACGTCCCGTCCTATCTACC
CAAGTCCTTGCTGCACCTAGTACTCCTTGGGAACCAGATTGAACGGATCCCTGGCTATGT
GTTTGGCCACATGGAACCAGGCCTGGAATACTTGTACCTGTCATTTAACAAACTTGCTGA
TGATGGCATGGACCGTGTCTCCTTCTATGGGGCATATCATTCTCTGAGAGAATTATTTCT
GGATCACAATGACTTAAAATCTATACCACCTGGGATACAAGAAATGAAAGCACTACATTT
TCTGAGGCTGAACAACAACAAGATACG
gtaaattttggctttttcaagtatctgtttaaattttggttggcaaaatatatgataaaa
caaccatgacatgatctctgggatttacgttaagggaaaaaaaaatggtgctaaggggtt
ggattaaacaagattggcaaatgttagtaattaccaaaggtggatgacaggtatgtgagg
EXON 10  1167 bp
tagtgcttctatggcttcatctttcacatttgaatctctgacgtagttggaatttattct
ggtctataaggatccaactttattttaagaacaaaatttttttaacaaatgttaaactta
actcctaaaggcagattattactgggaccatgtgtgacttgcatgtctatttttccttag
GAACATTCTTCCAGAAGAAATTTGCAATGCTGAAGAGGATGATGACTCAAATCTGGAACA
TCTTCATCTTGAAAACAATTATATTAAAATTAGAGAAATACCATCTTACACATTTTCATG
CATAAGATCATACTCAAGTATCGTTCTTAAACCACAAAACATCAAGTAATTCCAAGTTTT
CCTTTGCTGTTTATAAACTTTACTCATGTATTTGTAGTAGCTGCATTTGTCATTAATAAG
AGAGACATAATCCTCCTGTTATACTCAGTATCATTATATGCTAGTCAACCTGATTCACTA
ACACACAGATGAACAACCAAAATATACCTAAAAGGTATAGTCTCTAGGAGTTTTATTAAT
AGTAAAGGTAAAATCTCTCAGTTTCCTACCTCTAGAAAGAGGCCATCTCACTAGAATAGG
ATATTATGCATACTGAGCTAGACCAGAAGAGTCTGGAACAAAATAAACACAGCCTTTATA
ATCAACTTGAATACTGGTGTTAGCTGAGAACTCTGTAAGTCCCTTTAAAAATTATGTATC
TTTTGGTTCAAGATTAAGAAGCATAATGACAACAAAAAAAGCAGGCAGAATTTATGAATA
AGTGTTGTTTATTATTAAAACAATAATTTGTTAATTTCTTATAAGGTCCTGTGCTATAAT
TACTGGTATAAATATAACTGAATATTGGGGTAGCTTTCATTTCTTCCATTAATTACATGT
GTAAAATTAAAACACTACTGTAATGTTAATTTCCTGGTTTTGAAAATCATATTATGGTTA
TGTACATTGTTAACATTAAGGAAAGCTGGCAGAAGGGTGTGCATAAATTCTATACTCTTT
TTGAAACTTTTCTATAATTCTAAAATTATTTTTTAAAGTTAAACAGTATATTAAGATTAC
CTTCACTATTCCTCACTCAAGATTAAGACATTTTTTGAAAAGCAGTAGAGTTTGCTTAAA
ATACAAATTAATTATTCTTGACTATAACCTTGTAAAGGTAAATCTAATGTATAAATTTTT
GAAAAATTTTGCACCACTGGTCATAGCATCTATCTCCTTTGCCTTAATTTACTGAAATAC
ATCATTTTATTCGGTTCAATTGAAATAAAGCTATGTCTTTACTATGTATTGGCCCTACCA
AAATCATATATTAAAATTTTCTAACAT
aatgatttttatctttgtattgctaaagtaatttataagacacatatagaaactatgttg
acttcttttgttactctcagttttatgtcttggctaggaacttaagtgccagtgttggcc
tcattgcataggtttctctaattttttaagctttagttatttaatcatttaatagttctt