Gene DIRAS2 Variant 1
DNA : 2.50 KbNT_008476
mRNA : 2505 bp NM_017594
CDS : 600 bp NP_060064
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  2505 bp
tcgtctgtccttttgaaaacggcggattgaccaaatttattggatttagaattgtcgcta
ttttaaatgttatcacctcccatttttaagctatcaaaagagggtagagctatccttatt
aatgtttttatattttaattattaattctttcaaacatctggttcctttgctaggtgcgt
CCTGGCTGAGAGTTGGAGCTCTCCAGCAACATGCCTGAGCAGAGTAACGATTACCGGGTG
GCCGTGTTTGGGGCTGGCGGTGTTGGCAAGAGCTCCCTGGTGTTGAGGTTTGTGAAAGGC
ACATTCCGGGAGAGCTACATCCCGACGGTGGAAGACACCTACCGGCAAGTGATCAGCTGT
GACAAGAGCATATGCACATTGCAGATCACCGACACGACGGGGAGCCACCAGTTCCCGGCC
ATGCAGCGGCTGTCCATCTCCAAAGGGCACGCCTTCATCCTGGTGTACTCCATTACCAGC
CGACAGTCCTTGGAGGAGCTCAAGCCCATCTACGAACAAATCTGCGAGATCAAAGGGGAC
GTGGAGAGCATCCCCATCATGCTGGTGGGGAACAAGTGTGATGAGAGCCCCAGCCGCGAG
GTGCAGAGCAGCGAGGCGGAGGCCTTGGCCCGCACATGGAAGTGTGCCTTCATGGAGACC
TCAGCCAAGCTCAACCATAACGTGAAGGAGCTTTTCCAGGAGCTGCTCAACCTGGAGAAG
CGCAGGACCGTGAGTCTCCAGATCGACGGGAAAAAGAGCAAGCAGCAGAAAAGGAAAGAG
AAGCTCAAAGGCAAGTGCGTGATCATGTGAAGGCCCTTCCTGCGGGAGGAGCAGCTGTGT
GTCCCCGGCACCTCACTCCCCCAAAATGACACCCACCGTCGTCAGGGTAGCATGTATAAT
GCCCACGTGTTAAACATTGCATTTAATCGAGATGCGTCCTATTGTCCTTAAGAGGGCGTT
TCACACCACCAACAGTAAGCCACCCACTCTGGAGTCACAGAATCTGCCAGGCGGTTCAAG
TGAAAACCAACACACTCAGCATCCCTGGGAACTGAGAGGTGCCAGCAATTGCTGAAGGTG
GCGATGAACACCCGAAGGTGGGAGGGAGGACTGGTACCCACAAAGCAACATGTACCGAGA
GGACTAAATGTCATCTACGTGCATGTGAGAGCGTGTTAACCTAGAGTTACCTGCACCAAC
CCCAGACAGAAGCCAATCACATCTTTGGGGGAGGGGAGGGGCAGGAAGAGGTGAGAAGAT
CAGATGGTCCAAAGTGGACCACACTTGGTCCATTTTACACTTTTTTAAAGGGGATTAAAA
AACACAGCCTCTCCCCCAAAGGGTGTCCGTTCTTAATTCCCACCTGGCCTGTTAGGAGCC
TTGCTACCCTGAGGGGATGTGTTCACCTTACCTAGACCTAGTTAGGAAGTATCATTTTAA
GCTATTAGAGTATTTATCTTCATGTGCAGGGATAAGTGCACTAACAGTGTGCTGCTCTGT
CGGAAGTTCTTCAGTTTTTAAGTGAGGATATCGTGACAGTATTAAAACATCGCAATAATG
TTCCTGTGTGTTATACATCGAGGGTTTTAGAAATGTGATTTTCTTCTTTTGACCTGTGAG
GAGTATAACTTCTTTCAGCCCTCAGATTTTAAATACAAGCAAATAAACTCACTATTTTTA
GACGTTTTTTTCCTCCAAGGTGGTTTTCTTCTCTTAAATAACTCGATCTGTACCCAGCTG
GGTAGCAGCCAGCAAAGGCCATCAGACAACCAGAAGCACATCCATTTTTGTAGTGTCACA
AACATGTATATGCCACACTTTGCACCTTAATGAAATACTTTGAAACAGAAGTTATTCACT
GTGTTTTTGATGATCTATCTGTATTGGAAATATGTTCCTGGAAAATGCATTTAAATAATA
GTAAATTCTCTTGCATGTTCCATTATACGTGTCTTCTAAGAGCTGTTCAATACAGTATTC
ACTCTAGAAACAATTATCTTTTTCTCTTAATGATTTTGTGTGCATCTTTAATCTTTCAAG
CCAAATTACAGCTATTTCAGGTTTCCTGTGTTAGCTTGGGGATAGGATGGTGGCTGGAGA
CAGGCAGGCTTCTCTGCCCTGGGAAGAGCCCACTCAGCTTAATTGCTCTGCCATCGTAGA
GCCTGGTTGGACTTGGCTTCCTGAAAACTCCCACTGATAGTGCCTGTTAGATCTCCTGTT
TGTTTCAGTTGGCAGAACATTTACTGGCCCCAACTGTGGCATCATCCTCTCAGCAGTCTT
CCTGTCACCCGCCTGGCAGGCAGAAGGAGCTGCAGTCCCACGTGGGCCTGCCTGGGGGGG
TGGGGGCTGCATGGCTGTTGGGTGGCAGTGTCAGCACAGGGAGGGCTTAAGTTGGGGATG
TTTGACCAGGCCACCTCCTGCAACTGCTGTTTCTCCTGTCCCTCCTATGCAGGGCTTGCA
GCAGCAGCAGTGTGGCCATCTCCATCCCCCAAAGCACACTTGCTCTCTCAATATGTCCTA
GTTTTCTTCAGCCTTTTCTGGTTCAGTTCCCTTGTCCTGATCTCATCCTCTCTGGTCTCC
CAATAACTCACCCTTGGGATGTGTTTAGAGCGTGGGAGGTGCCTTTGAGAACTGCTTGAC
TCCATGATCTCCTAGAACAAAACCGCCCTGACTTTACAGGGGGAA
cactcatgctgagctgagaaagcagagaagtggcgtgggagccagctgggggtgaagagc
atttgggccagtcccgtggcccccttcagattcctcaagcaggattgttctgttctaaaa
agctgttgcacagcattcgcaatgagatctttagttggcggattttctggaacatttgtt