Gene DAPK1 Variant 1
DNA : 210.75 KbNT_023935
mRNA : 5893 bp NM_004938
CDS : 4294 bp NP_004929
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  227 bp
gagcgcggagctgggaggagcagcgagcgccgcgcagaacccgcagcgccggcctggcag
ggcagctcggaggtgggtgggccgcgccgccagcccgcttgcagggtccccattggccgc
ctgccggccgccctccgcccaaaaggcggcaaggagccgagaggctgcttcggagtgtga
GGAGGACAGCCGGACCGAGCCAACGCCGGGGACTTTGTTCCCTCCGCGGAGGGGACTCGG
CAACTCGCAGCGGCAGGGTCTGGGGCCGGCGCCTGGGAGGGATCTGCGCCCCCCACTCAC
TCCCTAGCTGTGTTCCCGCCGCCGCCCCGGCTAGTCTCCGGCGCTGGCGCCTATGGTCGG
CCTCCGACAGCGCTCCGGAGGGACCGGGGGAGCTCCCAGGCGCCCGG
gtgagtagccaggcgcggctccccggtccccccgacccccggcgccagcttttgctttcc
cagccagggcgcggtggggtttgtccgggcagtgcctcgagcaactgggaaggccaaggc
ggagggaaacttggcttcggggagaagtgcgatcgcagccgggaggcttccccagccccg
EXON 2  170 bp
aggggtcgggggcgtccctggccgcccagctttaacaaagggtgctcctctccaccccgc
gaggaggggcagctccggagacccggtcttcagcgagcggggtcttagcgccggggaggt
ctacttccttttggggttgccattttactattattattgccttttttttttcttcaaaag
GACTGGAGACTGATGCATGAGGGGGCTACGGAGGCGCAGGAGCGGTGGTGATGGTCTGGG
AAGCGGAGCTGAAGTGCCCTGGGCTTTGGTGAGGCGTGACAGTTTATCATGACCGTGTTC
AGGCAGGAAAACGTGGATGATTACTACGACACCGGCGAGGAACTTGGCAG
gtaaagggggtaccagaagcgtaccctcctggattgtggaaatgcataacgatggggcca
ttgggtggtaaacaaatgcagtttgaatcaggcgtctccctcgccctttctggagatgcg
caaatcatagagaaaagagttactaacccagcggtaaaccgcctgatccaagggcctggg
EXON 3  222 bp
aagaaacaggcttagtgtaaatgaatgatgataagaaacatccctacctaatttgttact
ttccacaattggaactttcctattcacagttctcttgtccccctctgcaccatgccacat
cctcactcaaatcctgttttttttatgaacgataaagaatcctccatcttctcttttcag
TGGACAGTTTGCGGTTGTGAAGAAATGCCGTGAGAAAAGCACCGGCCTCCAGTATGCCGC
CAAATTCATCAAGAAAAGGAGGACTAAGTCCAGCCGGCGGGGTGTGAGCCGCGAGGACAT
CGAGCGGGAGGTCAGCATCCTGAAGGAGATCCAGCACCCCAATGTCATCACCCTGCACGA
GGTCTATGAGAACAAGACGGACGTCATCCTGATCTTGGAACT
gtgagtgccgcctgggccaggctggggagagggtgtggtgggcgtcagctggcatcttcg
ttccagctggaccacgccacagcgagcccgagagagggatcaggaattggttctgctgta
tgaggtgtgtgagaacaatgccgtgctgcctgacctgaaacccagctgcagggatctaga
EXON 4  139 bp
gtgtctgaatgcagaattgtcaacaacctgcacagagaattctgaatccatgcttggcgg
tttcagcatagtctttatgctgttttcttgtctgaagtttgagcgcaccaatagtctatg
agagaaggaatcaatatgaaacagagttgttaccaataacctctgcttccgggttctcag
CGTTGCAGGTGGCGAGCTGTTTGACTTCTTAGCTGAAAAGGAATCTTTAACTGAAGAGGA
AGCAACTGAATTTCTCAAACAAATTCTTAATGGTGTTTACTACCTGCACTCCCTTCAAAT
CGCCCACTTTGATCTTAAG
gtacgtttcaaagtgtaagccagatagaagcttgtgcagatcacagccttggttgtttct
ctgctaagaaaaattgaggcatctgaaagagttacatgattttcctgtaccagtttaaca
aacagaaatatcactataaatcggcaagcataggatacatgccccccactgggatggcta
EXON 5  130 bp
caggcctgcttcagggagaacctagagcaagacatgtattttcctgctgttctcttccaa
ccaccctttcttccctactttttggccttttttttttttttggagagaagaactattctg
ccatcttgtcctcagcataacatatcatagctttttatttatctctctctttttttcaag
CCTGAGAACATAATGCTTTTGGATAGAAATGTCCCCAAACCTCGGATCAAGATCATTGAC
TTTGGGTTGGCCCATAAAATTGACTTTGGAAATGAATTTAAAAACATATTTGGGACTCCA
GAGTTTGTCG
gtaagtttctttgctcctgtggtcatttacgtctcataaacattattctggcaaacctcc
cctgctagaagattctttccctgctacatgttcctggttgttgcatgaagatagaatcgg
ttagtttgcttcctcccaagctaaatgagtgtttgtttcctcttagctcctgagatagtc
EXON 6  49 bp
tccagagtttgtcggtaagtttctttgctcctgtggtcatttacgtctcataaacattat
tctggcaaacctcccctgctagaagattctttccctgctacatgttcctggttgttgcat
gaagatagaatcggttagtttgcttcctcccaagctaaatgagtgtttgtttcctcttag
CTCCTGAGATAGTCAACTATGAACCTCTTGGTCTTGAGGCAGATATGTG
gtaaggagtatgtccttggtgttgtttgctttctgatttatttgactattcttctgacat
gtttttttgtttgttttgtgttgtttttaggagtatcggggtaataacctatatcctgta
agtatcagaattcacaactcatactctcttctcttctatgagaccataggtttaattaac
EXON 7  27 bp
ttgcttcctcccaagctaaatgagtgtttgtttcctcttagctcctgagatagtcaacta
tgaacctcttggtcttgaggcagatatgtggtaaggagtatgtccttggtgttgtttgct
ttctgatttatttgactattcttctgacatgtttttttgtttgttttgtgttgtttttag
GAGTATCGGGGTAATAACCTATATCCT
gtaagtatcagaattcacaactcatactctcttctcttctatgagaccataggtttaatt
aaccattaaatgtgctgtgttgatctcttcagcttatgcatgcttttgatgcaaacatat
tcattttacacccccaaaacatgtttagtttatactaattaaacatgttctcctaatttg
EXON 8  153 bp
ccttttgcctgaagctgaagcatttgctcctgacagttaaagccctatgaaatataatca
aactgtgactattcgagcaccagattataatcttattccacactccagatgttataggag
caaaatgacaacaccaaggggtcatcattaatgttctatgcccaactttatttttaacag
CCTAAGTGGGGCCTCCCCATTTCTTGGAGACACTAAGCAAGAAACGTTAGCAAATGTATC
CGCTGTCAACTACGAATTTGAGGATGAATACTTCAGTAATACCAGTGCCCTAGCCAAAGA
TTTCATAAGAAGACTTCTGGTCAAGGATCCAAA
gtgagtgtccacgttcctgaaaggtgcttggccacggcctcagccagcccagagcctgtg
tctgttccatgcacagggccacgttcctcagaccctgcttgcttcatctgccaaagggca
gcatgccatgtgaaacgcttcagaaaatgcaagcagggccctctgcccccactcagtcag
EXON 9  46 bp
ctcagtcagtccctgcaggcacagtgaaataatcacaaaaagaccgatgttgtttttggc
tttcttccctgaactgcattttccacagtatctgcttggcaggcccagccagcatgaaaa
caaccttagtatttgctgctatggtcacagcattttttttcttctccccctcccctcaag
GAAGAGAATGACAATTCAAGATAGTTTGCAGCATCCCTGGATCAAG
gtgagttgcatattacgaaactgtttagatcactttctatgtgattggtttgggcaccct
ggtattcatgtatcatagagtactgctaaccacaggtcacacctggagtgttaagtttgc
tatttgcatcgtatcttaagaaaagctgacaggttagactgtatactaatgatcccagag
EXON 10  90 bp
agaagagtgagcccgctaagactaggtgcctaggtattccatgttatcccaacttcttat
gctaatttaataaggtgaatgtgtaagcatcctgaataaggagatgtttcaaaaaattgt
catataacacattttcataatttgagagctttaattttttttcttggatttttattttag
CCTAAAGATACACAACAGGCACTTAGTAGAAAAGCATCAGCAGTAAACATGGAGAAATTC
AAGAAGTTTGCAGCCCGGAAAAAATGGAAA
gtaagattgtttgttgtggagggattaacaaattctgtttcctgtgtagagtagtgtgtg
gtcagggtgcatctcctctgatactggtaatatggaagatacatcctttcctctttttaa
tccaccctgtagtgttctgcaccattactctattttgaaaaacaagcaaaaacaatattt
EXON 11  93 bp
cccattctgctgtaggattgcccaccctgggagagtgtgtgctgatagcaatgaacacga
tctcgcaggctttgtcgtttgtactcatttgacaattgttacataagctgtctctcctcc
tctcaccctgcctttttcctccccgccctccctttttttttttttttttttaaaaaaaag
CAATCCGTTCGCTTGATATCACTGTGCCAAAGATTATCCAGGTCATTCCTGTCCAGAAGT
AACATGAGTGTTGCCAGAAGCGATGATACTCTG
gtaagcaaacccgtgagccctggtgctcctttcttagcactgggtactcagaatgaccaa
gctgttctatttgttcaacctcccaggaacctgaagttgtggaaatggcaagcttattct
tgatcccctcggaggggtttgggggtgctgattgatgcaccctcttgcttctttcctctt
EXON 12  120 bp
acatggaaggggcaaaaattccttcctaggtccctccatgactgtatggatttggggagt
aaatggcttactttcctctgaatgcccctgttaacaagtgagcacaggtttcttttatgt
tggtaagaaaagcatggctagcaatgtaactctgtttccatcttggctgtctctctcaag
GATGAGGAAGACTCCTTTGTGATGAAAGCCATCATCCATGCCATCAACGATGACAATGTC
CCAGGCCTGCAGCACCTTCTGGGCTCATTATCCAACTATGATGTTAACCAACCCAACAAG

gtctggttctgttctgccgcatactggaggggtgggtcacagcgaccttgcccttccata
tccaaggaaagaccccatctgcttctccattctcccttccaattggaagctccatactgt
ggggaaaatcacttctgtttagaaagtgatttgagttacaaataaggtctttgtgcattg
EXON 13  99 bp
agaatccaaaaggggaaggaaaggttttatacccttccacctgtcttctcttcctgccac
gcagtggtagctctatgtctgttgagacaggggaaggtgtgtggtaacagcaatcatcgt
ttgggcttttcctttcctaccaaacctgaaaattagtaatttttttcttgcctattctag
CACGGGACACCTCCATTACTCATTGCTGCTGGCTGTGGGAATATTCAAATACTACAGTTG
CTCATTAAAAGAGGCTCGAGAATCGATGTCCAGGATAAG
gtcataattgttttattgaaatgaattgaattttaaagtattttcaagtgtctcttaatc
ataggggtaacagaggaaaaaaatttatgtcctaacttgtttctcagtttcctgtaaagg
aagatgagctgcttttaaacagcttggtacagcctgacacatgggttaaagaggcaaaca
EXON 14  99 bp
gtgtaaccacggtacatttgtcaaaggtgtaaaatagaatgagggttttattcctctggg
aagttgctcctctggggtttgtcatcacacaggaagggaaataacagtgagtctgaggaa
tgcatgcatctggtgctgtcagctccctagaaatgtgaccccaggttgattttcctgcag
GGCGGGTCCAATGCCGTCTACTGGGCTGCTCGGCATGGCCACGTCGATACCTTGAAATTT
CTCAGTGAGAACAAATGCCCTTTGGATGTGAAAGACAAG
gtaaggccacttctcttaggaggaacatgaggtggtagtaaatggatgcatgtgagtgtg
agtgctggcctaccgtgtgcatcgggacccaaaggaaaggaatcaggaccagaattcacc
tgcagaacatttaagttggaaatgtcttgttgcctgtggtttggtctaatactgaaatca
EXON 15  98 bp
tggacaccccaacctcaggtccccatcctagccactataggggcatctgcccaaggtggg
tgggtggaaccaaaggggacagagtggaaccaggcaggcctgggtgtaggccttgggttc
tggtctccatagcctgctcacagatgtggctctgaatcaccggctccttttcttctgcag
TCTGGAGAGATGGCCCTCCACGTGGCAGCTCGCTATGGCCATGCTGACGTGGCTCAGTTA
CTGTGCAGCTTCGGCTCAAATCCCAATATCCAGGACAA
ggtgggtcgtgactgacatcctcccttcctctgctctatacatgaatgtacaggcagcca
gatggtacagtcggggcctttagagttttatccaagctaggctttctgtcttcccctaca
gagggcaaggctcaaggggcagggactcaaacagaagtactagctaaggtgtgcaaggtg
EXON 16  200 bp
gtggctcacactcatgttgttattttattccagattaatatttcactccaatacctatga
gctctttccctctgctgccttggttgcgtttctgccaaatttgacagggactctcacctt
gctttatactttgtttctcattattgtgttctcctcctctctgtactcgtctccttggcc
AGGAAGAAGAAACCCCCCTGCACTGTGCTGCTTGGCACGGCTATTACTCTGTGGCCAAAG
CCCTTTGTGAAGCCGGCTGTAACGTGAACATCAAGAACCGAGAAGGAGAGACGCCCCTCC
TGACAGCCTCTGCCAGGGGCTACCACGACATCGTGGAGTGTCTGGCCGAACATGGAGCCG
ACCTTAATGCTTGCGACAAG
gtgccttatgggggaagactcatatgcactgggaagtgatctaggggtctagagggacca
caagactcctcagtttgtttccctaagataacaaacttgaatgcagcaaactgtaattac
cccgtctcttctctgttccaaagattctgtgaacttttctatattgtatttaatagttaa
EXON 17  198 bp
tcctcccagtccttacccctgctataggagtaaagtttcttcatttaaatcctccactag
ggcttttagtagtgatcttgttgccaattaaacctcactcgatggcggcagaaaaggtga
agagacggaggccacatgcccaagtgaaaagctctcatgatctctggggtttgtttccag
GACGGACACATTGCCCTTCATCTGGCTGTAAGACGGTGTCAGATGGAGGTAATCAAGACT
CTCCTCAGCCAAGGGTGTTTCGTCGATTATCAAGACAGGCACGGCAATACTCCCCTCCAT
GTGGCATGTAAAGATGGCAACATGCCTATCGTGGTGGCCCTCTGTGAAGCAAACTGCAAT
TTGGACATCTCCAACAAG
gtatgcacagagaacaggatccctacagcttccaactgtgtccatccacccgattctggg
tcctgattctgtgtcctctcacctgatcccaggtcctgattctgtgtcctcccacctgat
cccgggtcctgattctgtgtcctcccacctgatcccgggtcctgattctgtgtcctctca
EXON 18  99 bp
cttggaaaggttctgcctggctggcctgccccagtggagagcaagtttcaggagaaggga
gatggctccttcctcctttctggtgggccctgaccccttccttaaccttgtgtctccgga
atgtcatcctcagcaactgcgtgagaagaacgacctttggccttttttctctcttcccag
TATGGGCGAACGCCTCTGCACCTTGCGGCCAACAACGGAATCCTAGACGTGGTCCGGTAT
CTCTGTCTGATGGGAGCCAGCGTTGAGGCGCTGACCACG
gtgagtgcccacagggcttcgtgaaggagggagctgctgggagcctctggcgcctccagg
gcaggagggacagggcttgtatggcaactctgcattctgaagcagccaggctgctgttca
gccatagctcctccactgcggtaacatagacattcgcctacacatgcccagcctaatgtc
EXON 19  78 bp
aatcaagtgaaataaggattgcacagccagagaaacacaccgagacgtgctctttgtcca
cctggcttgcttctcacacctgctatgcttgtttctgcctcagacccacggaattggcgt
atggaacacacacagctctccttttcagagaaaagaaactaatgcatttttctccaacag
GACGGAAAGACGGCAGAAGATCTTGCTAGATCGGAACAGCACGAGCACGTAGCAGGTCTC
CTTGCAAGACTTCGAAAG
gtgagaagttctgttataggtctgaagttctctacctgtgtttatgtgaaaaagtctcag
tctttttccttatttgagaatgagcaaaatgaggctctagacagccaggttttaggaaca
gtggtccctgtcctgtggtttacatgtcagtcggtataaatgcatcagctccctatctgt
EXON 20  223 bp
gctgagatcgtgccattgcactccagtctgggcaacaagagtgaaactccgtctcaaaaa
agaaaaaaagaaacatatcttcagcatgggtaaaaactgcacaccggggattaggaatct
tgagaatcattatttgcctctttttctgtcactcactggctctttctcatccatgctcag
GATACGCACCGAGGACTCTTCATCCAGCAGCTCCGACCCACACAGAACCTGCAGCCAAGA
ATTAAGCTCAAGCTGTTTGGCCACTCGGGATCCGGGAAAACCACCCTTGTAGAATCTCTC
AAGTGTGGGCTGCTGAGGAGCTTTTTCAGAAGGCGTCGGCCCAGACTGTCTTCCACCAAC
TCCAGCAGGTTCCCACCTTCACCCCTGGCTTCTAAGCCCACAG
gtaggaacctccatgctggccccgtctctccagcaggtgttggcttccgcactctctcct
ttcaaggtctaggggggaagggagttgtgtttgggtcacttggcctatactggaccctgt
ggccttagtggttttcaggtccaggttggctggtagccttgtgtgtgctgcctgttgtcc
EXON 21  189 bp
cagccttgctgggaacactgctgccctgcacgtgtgagggcagacacactcagcctgaag
ccagagttggggtggggacagaggcgtgctccagaaaaggaaacctcagggccagcctgg
gagggagacaggcacacgctgcccccatcgagtactcatgtgatcctttccatcctgcag
TCTCAGTGAGCATCAACAACCTGTACCCAGGCTGCGAGAACGTGAGTGTGAGGAGCCGCA
GCATGATGTTCGAGCCGGGTCTTACCAAAGGGATGCTGGAGGTGTTTGTGGCCCCGACCC
ACCACCCGCACTGCTCGGCCGATGACCAGTCCACCAAGGCCATCGACATCCAGAACGCTT
ATTTGAATG
gtatgccctgcctgccccaagggaaggacctcaggtttcccttcaacagggttgtaagtc
atccctaaagggagcttgtcctgagctgtatctgtcacttccagaaggaaatccaacaca
gactgatattcagagtgagccaggactgaagcatggctggctaccatccctaaacagtga
EXON 22  198 bp
tcaatatgagttttagtggggaacaaaccatacccaagtcataacaagatgtatacacat
acagaagaatgccataagtatcactatgcctacttcgaatccgtggaacgctaagagaat
ttatgattgaaatttggttagtggtgtttcacgattgttatcatttttctttttctgtag
GAGTTGGCGATTTCAGCGTGTGGGAGTTCTCTGGAAATCCTGTGTATTTCTGCTGTTATG
ACTATTTTGCTGCAAATGATCCCACGTCAATCCATGTTGTTGTCTTTAGTCTAGAAGAGC
CCTATGAGATCCAGCTGAACCAAGTGATTTTCTGGCTCAGTTTCCTGAAGTCCCTTGTCC
CAGTTGAAGAACCCATAG
gtgagctaagtccctgcaggccagtgatgtcctacctgtggttggccaggaatcgcctcc
tccttccaggcttctgccctgctcctgccactgctgctgctggccttgcaccaggccatg
agcagatcccaccgtttgtggctaacagctgagccaacttcctttctccttcctgctggg
EXON 23  139 bp
gctggggccttctagggtcacagtgcacagcaggcgtggggccttcatctctgtggcatg
ttgcacttgtacctggagagtcggcctgggcatgaggccaacacaccgccctcacctggg
caggagaggcagccaggtaggaggacccaccccctgaagcagttccctctctgcccccag
CCTTCGGTGGCAAGCTGAAGAACCCACTCCAAGTTGTCCTGGTGGCCACCCACGCTGACA
TCATGAATGTTCCTCGACCGGCTGGAGGCGAGTTTGGATATGACAAAGACACATCGTTGC
TGAAAGAGATTAGGAACAG
gtgaggggcagccacttagtctccagctcacgggtagcctcctctccctgagaactgaag
cagaggtgtgaaaagtacaaaggaagtctcatgaaccagagaaaggttttaaaggtcttt
ctttcttggtcaactcttttcttgtacaggtcttgtatcccttattggaaatgatcggct
EXON 24  121 bp
ctgcacccactgtgatgaggcagagcccaccaacagcagggatggggaggggcctttgca
aggacaccagaactttccttccctcctaccagcctcttgagccagtaggagcctggcccc
tccattaaaaggcctggggacattgactcactgctgaggaggctgctgctcttcccttag
GTTTGGAAATGATCTTCACATTTCAAATAAGCTGTTTGTTCTGGATGCTGGGGCTTCTGG
GTCAAAGGACATGAAGGTACTTCGAAATCATCTGCAAGAAATACGAAGCCAGATTGTTTC
G
gtaagtacaccatggaaagagcctggacccctttgtacttccttcctggtttgcctctgg
tttcagggaactgcttcatagtaggacccagtaagaggtgtctgcctggacatgtcttta
tcctagtgccctgggaaaagaaaggaagaatagagaaacaaggagatgatgggagctgaa
EXON 25  189 bp
gggcaatagcgagacccagtctaaaaaaagaaaaaaaaacgtcaacaacaacaaaaaaac
ccactcgttcatcaaatcacctgcaaggcgcctgaatgaaaggtgtcctttccactgtgg
ctctgctcagggcacccacagctgcaggtgagttaacctgtctggccctgccccctctag
GTCTGTCCTCCCATGACTCACCTGTGTGAGAAAATCATCTCCACGCTGCCTTCCTGGAGG
AAGCTCAATGGACCCAACCAGCTGATGTCGCTGCAGCAGTTTGTGTACGACGTGCAGGAC
CAGCTGAACCCCCTGGCCAGCGAGGAGGACCTCAGGCGCATTGCTCAGCAGCTCCACAGC
ACAGGCGAG
gtgagcccctgggagcccaggcagggggccgtgagaggtgccagggactcagcctgtccc
aaattccagctcttggaagtggtgtgagcctggggaagcagtgtggaaatggtccagcta
acctacaacatttccacacgtgtgacaaacacagcctcaagtgacgctctgaactgcagt
EXON 26  2497 bp
tgcttttctccactcggtgtttggtttttgagacgcatccacgtggaatggccttgggtc
actccttagagcatctgctcagcctctgttgccggcatcaggccctttagtgctctaagt
ggctggtgcacctggccagggctctgtccctaagcgtgactttctgttgtccccccgcag
ATCAACATCATGCAAAGTGAAACAGTTCAGGACGTGCTGCTCCTGGACCCCCGCTGGCTC
TGCACAAACGTCCTGGGGAAGTTGCTGTCCGTGGAGACCCCACGGGCGCTGCACCACTAC
CGGGGCCGCTACACCGTGGAGGACATCCAGCGCCTGGTGCCCGACAGCGACGTGGAGGAG
CTGCTGCAGATCCTCGATGCCATGGACATCTGCGCCCGGGACCTGAGCAGCGGGACCATG
GTGGACGTCCCAGCCCTGATCAAGACAGACAACCTGCACCGCTCCTGGGCTGATGAGGAG
GACGAGGTGATGGTGTATGGTGGCGTGCGCATCGTGCCCGTGGAACACCTCACCCCCTTC
CCATGTGGCATCTTTCACAAGGTCCAGGTGAACCTGTGCCGGTGGATCCACCAGCAAAGC
ACAGAGGGCGACGCGGACATCCGCCTGTGGGTGAATGGCTGCAAGCTGGCCAACCGTGGG
GCCGAGCTGCTGGTGCTGCTGGTCAACCACGGCCAGGGCATTGAGGTCCAGGTCCGCGGC
CTGGAGACGGAGAAGATCAAGTGCTGCCTGCTGCTGGACTCGGTGTGCAGCACCATTGAG
AACGTCATGGCCACCACGCTGCCAGGGCTCCTGACCGTGAAGCATTACCTGAGCCCCCAG
CAGCTGCGGGAGCACCATGAGCCCGTCATGATCTACCAGCCACGGGACTTCTTCCGGGCA
CAGACTCTGAAGGAAACCTCACTGACCAACACCATGGGGGGGTACAAGGAAAGCTTCAGC
AGCATCATGTGCTTCGGGTGTCACGACGTCTACTCACAGGCCAGCCTCGGCATGGACATC
CATGCATCAGACCTGAACCTCCTCACTCGGAGGAAACTGAGTCGCCTGCTGGACCCGCCC
GACCCCCTGGGGAAGGACTGGTGCCTTCTCGCCATGAACTTAGGCCTCCCTGACCTCGTG
GCAAAGTACAACACCAGTAACGGGGCTCCCAAGGATTTCCTCCCCAGCCCCCTCCACGCC
CTGCTGCGGGAATGGACCACCTACCCTGAGAGCACAGTGGGCACCCTCATGTCCAAACTG
AGGGAGCTGGGTCGCCGGGATGCCGCAGACTTTTTGCTGAAGGCATCCTCTGTGTTCAAA
ATCAACCTGGATGGCAATGGCCAGGAGGCCTATGCCTCGAGCTGCAACAGCGGCACCTCT
TACAATTCCATTAGCTCTGTTGTATCCCGGTGAGGGCAGCCTCTGGCTTGGGCAGGGTCT
GTTTGGACTGCAGAAGCAAGGGGGTGATGTAGCCCATCCTTCCCTTTGGAGATGCTGAGG
GTGTTTCTTCCTGCACCCACAGCCAGGGGGATGCCACTCCTCCCTCCGGCTTGACCTGTT
TCTCTGCCGCTACCTCCCTCCCCGTCTCATTCCGTTGTCTGTGGATGGTCATTGCAGTTT
AAGAGCAGAACAGATCTTTTACTTTGGCCGCTTGAAAAGCTAGTGTACCTCCTCTCAGTG
TTTTGGACTCCATCTCTCATCCTCCAGTACCTTGCTTCTTACTGATAATTTTGCTGGAAT
TCCTAACTTTTCAATGACATTTTTTTTAACTACTATATTGATTGTCCTTTAAAAAAGAAA
AGTGCATATTTATCCAAAATGTGTATTTCTTATACGCTTTTCTTTGTTATACCATTTCCT
CAGCTTATCTCTTTTATATTTGTAGGAGAAACTCCCATGTATGGAATCCCACTGTATGAT
TTATAAACAGACAATATGTGAGTGCCTTTTGCAGAAGAGGGTGTGTTTGAAATCATCGGA
GTCAGCCAGGAGCTGTCACCAAGGAAACGCTACCTCTCTGTCCCTTGCTGTATGCTGATC
ATCGCCAGAGGTGCTTCACCCTGAGTTTTGTTTTGTATTGTTTTCTGACAGTTTTTCTGT
TTTGTTTGGCAAGGAAAGGGGAGAAGGGAATCCTCCTCCAGGGTGATTTTATGATCAGTG
TTGTTGCTCTAGGAAGACATTTTTCCGTTTGCTTTTGTTCCAATGTCAATGTGAACGTCC
ACATGAAACCTACACACTGTCATGCTTCATCATTCCCTCTCATCTCAGGTAGAAGGTTGA
CACAGTTGTAGGGTTACAGAGACCTATGTAAGAATTCAGAAGACCCCTGACTCATCATTT
GTGGCAGTCCCTTATAATTGGTGCATAGCAGATGGTTTCCACATTTAGATCCTGGTTTCA
TAACTTCCTGTACTTGAAGTCTAAAAGCAGAAAATAAAGGAAGCAAGTTTTCTTCCATGA
TTTTAAATTGTGATCGAGTTTTAAATTGATAGGAGGGAACATGTCCTAATTCTTCTGTCC
TGAGAAGCATGTAATGTTAATGTTATATCATATGTATATATATATATGCACTATGTATAT
ACATATATATTAATACTGGTATTTTTACTTAATCTATAAAATGTCGTTAAAAAGTTGTTT
GTTTTTTTCTTTTTTTATAAATAAACTGTTGCTCGTT
gcattagtttttttgatctttaattcaaaaggatttctttttacttgttgtggttttact
gttgtcaccccacatagcaggacaacccagtccaaaacctagaaaatcattacacctcaa
ctctcagggttattgagatgccgattattactcaaattaggaatggtgtgggaaagtgaa