Gene ASTN2 Variant 1
DNA : 789.47 KbNT_008470
mRNA : 3812 bp NM_014010
CDS : 2676 bp NP_054729
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  337 bp
ggctggtggttcctgaggctctatgagccaaacccagggatcctggcagagtgtagtgga
caggaaaatcccctgcagccctcgattccaaagaacagtggcccatttgtgtgtccttcc
ttcctgctccagggtggcctcatcgcgctgctgctgctgctgctggtgttcaccgtggcg
CTGTACGCCCAGCGACGTTGGCAGAAGCGTCGCCGCATCCCCCAGAAGAGCGCAAGCACA
GAAGCCACTCATGAGATCCACTACATCCCATCTGTGCTGCTGGGTCCCCAGGCGCGGGAG
AGCTTCCGTTCATCCCGGCTGCAAACCCACAATTCCGTCATTGGCGTGCCCATCCGGGAG
ACTCCCATCCTGGATGACTATGACTGTGAGGAGGATGAGGAGCCACCTAGGCGGGCCAAC
CATGTCTCCCGCGAGGACGAGTTTGGCAGCCAGGTGACCCACACTCTGGACAGTCTGGGA
CATCCAGGGGAAGAGAAGGTGGACTTTGAGAAGAAAG
gtgagtcctccatgtcacagcccattttccagggggcattttgaaaagatgggaagaggt
gcagaagctgggcagttggggactacaggcagtgttttctgggataagccactttggatt
tatggctttagatttctgttgggttatcaagtttgtcttctctgattcttcagtagtgat
EXON 2  108 bp
cccaagatctgcttcactgcagagcatgaactccttccatttatcacactgactcctggg
ttgcttgggatttacagagaaaagtctggggatgggattgctgatctctgggatggttga
ggaatctcacaaacttctggaggcctgggagactaactgatagactgtgcttactcacag
GAGGAATCAGCTTTGGGAGAGCCAAGGGGACGTCGGGCTCAGAGGCAGACGATGAAACTC
AGCTGACATTCTACACGGAGCAGTACCGCAGTCGCCGCCGCAGCAAAG
gtaatagtgtccttggaaggttccagaaccagagtttgtagaaggaaatcctggaaatca
gattttgtgttcactagcaaatcctaaatcttctctaacctggtccccatctggttaaaa
ctgagcttagtatctgttgccctggctatatgggtgaccttcagtataatgcttttcctg
EXON 3  147 bp
gcccaaagaaggcccactgaggtgtcatagcaggcacaaaggttagaaaacatgtctttt
ttcttttcttttcttttttcagattcccaactggaaaataatagaattcccaaacttgat
gccaatcccatttcctcacctcatggaattttgtgtctttgtgtatgttcttgttaccag
GTTTGCTGAAAAGCCCAGTGAACAAGACAGCCCTGACACTGATTGCTGTGAGTTCCTGCA
TCCTGGCCATGGTGTGTGGCAGCCAGATGTCTTGTCCACTCACTGTGAAGGTGACTCTGC
ATGTGCCCGAGCACTTCATAGCAGATG
gtaagagccgagcattgcagatgctccacacccactcagcaccttgcacccctgactggt
caaaggtttctgtgtatggccaaaccttagaattactattacatatattacaggaggaaa
aaaaggagcatctaaagaccttggaagaggatcttatcctttgtaatctggattatttga
EXON 4  168 bp
gatttgcctctatctccctatgggcttgcaacaccatgacgggcacattgcaagtgcact
tagacaaatgagatcagatgacctggggaacgtggcttgtacacacctttctgtgttctg
tagcatcagctaagaccttaaaatcagtaagaaagtatctgtctctccgttcacccatag
GAAGCAGCTTCGTGGTGAGTGAAGGGAGCTACCTGGACATCTCCGACTGGTTAAACCCGG
CCAAGCTTTCCCTGTATTACCAGATCAATGCCACCTCCCCATGGGTGAGGGACCTCTGTG
GACAAAGGACGACAGATGCCTGTGAGCAGCTCTGCGACCCAGAAACCG
gtgagccatgggagccgggatggggatagaaggtgggagaggctgggttgaaagaggcat
tgtgctccctctacctaaagaaccatggattctgagccattgacaagtggctgaataaga
aggcccatcaatctaataaacactaatgtatgtgctgccattgcctttcaaggggggaaa
EXON 5  85 bp
aatgaacaaaggaataaactctgttaaccacagtggttgatggacaagattaccctcttt
ccatgtgccttttctaaaactaagcagctcactttatgtcttaggaaaacaagcaaacca
gagaaaagcctatttggggagactctacttaacaataatcttttttcttttcacttacag
GAGAGTGCAGCTGTCATGAAGGCTATGCCCCTGACCCTGTTCACAGACACCTGTGTGTGC
GCAGTGACTGGGGACAGAGTGAAGG
gtgagtggcaaagggcatcaggtccaggacagtgcaggacccacttttacctcctctgtt
ctgttaccagaggccccaagcatctccacaaagaggactctttctctgcaacagtagtgt
tcctgcaaaacccaatgggaagtgaatcctactttcccatggaatcacattttagtatta
EXON 6  75 bp
tgaaagtgctgaatccttctgtaaattggagacattcttttataatataagtagtcttgc
ccaataattatttctgcagagtttggttgtttgtaaagctactctagagcagtgtccaca
tgtgaattctacctgcctctgactaatgtcatcttctctcccctctccttcttcccatag
ACCTTGGCCCTACACGACACTTGAGAGGGGCTATGATCTGGTGACAGGGGAGCAAGCCCC
TGAAAAGATTCTCAG
gtgagttggctttcttgttggggcataattctgggaaatggagaaaggactgataggaag
atgtggtcatggatccttagactattgagcctgtgcacttctgagctgcactgagtacaa
aagaactctccctggcactaatgtaccatcatggcgcaggttgctatgggaatctaattc
EXON 7  138 bp
gatttgagaaatgatcatccaggtctggagaaagttggccaacattgttccttaaataat
gctggggatatggatggagaagtaggaaattgccctagaagggatgggaacaggggcccc
ttttttctgtttgctctctgcttcccagggagttccccaatggaaactcttacattgcag
GTCTACTTTCAGCTTGGGCCAAGGCCTCTGGCTTCCTGTCAGCAAAAGCTTTGTGGTTCC
GCCTGTGGAGCTGTCCATCAACCCCCTGGCCAGCTGCAAGACCGATGTGCTCGTCACGGA
AGACCCTGCAGATGTCAG
gtagggaatcatctccagtactctgcataggtacttcttaaaaccttggaagtccccctg
ttggagaaccacaggaacccctaaggagtgttcttgctgtttagttgatgtgaagaacac
tgtcaaatatgccatgctcctaaactcttagatgtgacctccatcactgtgtctcaatgc
EXON 8  151 bp
gacaagcaccgtgtcatatgatggtatacctgttgttgtttcctttttataatattgatt
attattgttttcctgattataagtaagttatggtttcaaatgtaatgaattcacattatt
atttttttaatctaaggatccaaatgtctctggggtttaaccatcccctttctctccaag
GGAAGAAGCGATGCTGTCCACATACTTTGAAACCATCAATGACCTGCTGTCTTCCTTCGG
GCCAGTTCGTGACTGCTCTCGGAACAATGGGGGCTGCACTCGCAACTTCAAGTGTGTGTC
TGACCGGCAGGTGGATTCCTCGGGATGTGTG
gtaagtgcccattggcccgggaacatggcagtggcccaggggctaaggccacctgctaga
agccctgccctgcgagggaacgctggtaaggaggatcatatccacactacccttatctgc
ctctgcggccttcagtatgccagcctaccttggtttcctcacctgtaaagtgagatcatt
EXON 9  167 bp
tgaggttcagagaagtaaagggacttgtggaacttgtcacaaagttattaactgacaaaa
ggagactgaatacctttctgtcaggccctgacacatgtctcttccaggagggaggagagg
gtgtgatggggcctacaacctcccaagccataactaccctgttgccctctctctgagcag
TGCCCTGAGGAGCTGAAACCCATGAAGGATGGCTCTGGCTGCTACGACCACTCCAAAGGC
ATTGACTGCTCTGATGGCTTTAATGGCGGCTGTGAGCAGCTGTGCCTGCAGCAGACGCTG
CCCCTGCCCTACGATGCCACTTCGAGCACCATCTTCATGTTCTGCGG
gtgagtctctgtccccaaggcccaggtgccccatttacagaagtgagggatgcatgggaa
aatgatcagacactacagctcagcaaggctgaaccttgaccttcaataaaatggcctttc
tgcctttcctgttttagtccaagagccaaaagccaaaagtataaccttctgttgggtggg
EXON 10  189 bp
ttgcagtattaatgtgcttctctctagacatctgtgccctagatagattccaggtagaat
agctgtctccttcctaaactctgacctgttttgcagggaaaggaggccttggttttaggt
cacccccaatgggggcattcaggatgtgaagctaattctgagctctgttttatcatacag
TTGCGTGGAGGAGTACAAACTGGCTCCTGATGGAAAATCCTGCTTAATGCTCTCAGATGT
CTGCGAGGGCCCCAAGTGCCTCAAACCTGACTCCAAATTCAATGATACCCTCTTTGGAGA
GATGCTACATGGTTACAACAACCGGACCCAGCATGTGAACCAAGGCCAAGTCTTCCAGAT
GACCTTTAG
gtatgctgtagatacttgcacattgcttgtctgagtcactgacaaacaacctgggcacag
ggaggaagccatgggcacaatggggtagagacctgttattctggccagcatcactttaag
ctcacaggtaccctcttaaggagtgtggaaagtcatcaaactttattccataaggtttct
EXON 11  125 bp
ttcaggaacctgtagttagcaccatgttctcagagctgggattcaggaaaccagaggcat
tacagcaaagtcaccccaccatgagtctttattctgactacagcatcctgcctccttgcc
ctgtagtcctcagcagtctccacttcctcgatttggcagtctctctgctcctctccacag
GGAGAACAACTTCATCAAGGACTTTCCCCAGCTGGCCGATGGGCTGTTGGTGATCCCGCT
GCCGGTGGAGGAGCAGTGCCGGGGGGTCCTCTCCGAGCCCCTTCCAGACCTCCAACTGCT
CACTG
gtaagacacatgtgccagacccttcccaggttccctgaccacacaccgagtctccacacc
tagtgcatatcagtcttcagcagatccaagatgggctctgtcaagcctcctccttcatga
ggaagggtatgggaaggaacttaccctttcttgggctcctgctattggctgagcagaacc
EXON 12  105 bp
gggctgagattagagaccagaaagaggcctggagggtggggttcataaaattgtcaatcc
cagtgaaagttgtacttcaaagaggtgtctgtttcccagagccaagagctgcagggtgaa
caatgtggtgtgaagcgtcttaattctgggctcacgtgaccatcttattttctctcccag
GAGATATCAGGTATGATGAGGCCATGGGTTACCCCATGGTGCAGCAGTGGCGGGTCCGGA
GCAACCTCTACCGTGTGAAGCTCAGCACCATCACCCTCGCAGCAG
gtgaggaccactgcctgggcagccaggggacttggaataatttagcacttgttgccaagg
acctagcatgtgccagggcatatgagagcactggggatgctgaggaaatgaggatgcatc
ctctctgccatcaaggagtcctagggagggtgggtggacaggagtctgacagacagtagg
EXON 13  180 bp
ttcattgctatttaagtgagggaattatgtatatgtttggactagtgcagccaccaagct
gccactgtgctgaggggtaaggcacaaaatacaggttgggaagaactcctgccaccgtat
aatttgctagccgccagcctctcacatctgaccacctccacatgctcctctcttgtccag
GCTTCACTAATGTTCTCAAGATCCTGACCAAGGAGAGCAGTCGGGAGGAGCTGCTGTCCT
TCATCCAGCACTATGGCTCCCACTACATCGCAGAGGCCCTCTATGGCTCAGAGCTCACCT
GCATCATCCACTTTCCCAGCAAGAAGGTCCAGCAGCAGCTGTGGCTCCAGTATCAGAAAG

gtaagcccggagtgcctactgtaggaggtggccaggcaggctatagaggcaaggggtctg
gggagacaactgagctgccttggatctaaatcctggctctgccacgtctaagctgtgtga
ccatgggcaagtccctgcctctctctgagcttcagtttcaccatgggcagagtgagggat
EXON 14  266 bp
ggcctttgaaccctcagtctggcagtctttccaaggcatcatgaataaatcactctatca
tctttttacttcctcaatggataccagcttcttagcatctgtattttgtgaattcaagag
tctggccttttgaataatcctgagtttacctttcgctcttcctgtcttgtgcctctccag
AGACCACAGAGCTGGGCAGCAAGAAGGAGCTCAAGTCCATGCCCTTCATCACCTACCTCT
CAGGTTTGCTGACAGCCCAGATGCTGTCAGATGACCAGCTCATTTCAGGTGTGGAGATTC
GCTGTGAGGAGAAGGGGCGCTGTCCATCTACCTGTCACCTTTGCCGCCGGCCAGGCAAGG
AGCAGCTGAGCCCCACACCAGTGCTGCTGGAAATCAACCGTGTGGTGCCACTTTATACCC
TCATCCAAGACAATGGCACAAAGGAG
gtgagctcccctggcccagccactcagtcaaacttgaccagccctcctacctcctaccct
tgtggaccctttgtccaggggtattgtcatcatgatcatcatcatatcatcatcatggtg
attactagcatttattgattccttaccatgttctaaatacttacatagtttgacaatact
EXON 15  134 bp
tggctcaggatgggagaccctgatagtagagtgcaaggaacttagggaatagatggtgtc
ttgtgcttaaaggggctactctaaagccctcgatggctcacatcatggccatcagcacat
ttactctcaatctctcccctgttgtcatcattgtctattctgtcctctttttttgtccag
GCCTTCAAGAGTGCACTGATGAGTTCCTACTGGTGCTCAGGGAAAGGGGATGTGATCGAT
GACTGGTGCAGGTGTGACCTCAGCGCCTTTGATGCCAATGGGCTCCCCAACTGCAGCCCC
CTTCTGCAGCCGGT
gtacgtatgtatggccccttttcctttggccatcccttttcgtggactcacactcctgtc
ctgccagcccatgccatgacttgcttctgctcccaaggtgcctaacaagatcctcaaaga
ccctggaatctacctccttttttaggaaagaagggagctttggcagaacagaattgtggc
EXON 16  149 bp
gaaacagaggccatgagaggggaaataacttgcctacggtcatgcaagttggcgatcatg
ggtggaatcaagatttaaattcagactgaaacctatgcttcatcttgacacatgcggatt
cttttgggccccagctggtgctggctgccaaacacgaatcttcctttttattccctgtag
GCTGCGGCTGTCCCCAACAGTGGAGCCCTCCAGTACTGTGGTCTCCTTGGAGTGGGTGGA
TGTTCAGCCAGCTATTGGGACCAAGGTCTCCGACTATATTCTGCAGCATAAGAAAGTGGA
TGAATACACAGACACTGACCTGTACACAG
gtaggtacatgagttcccattttcttgggatagtatgacagaagagggaaactgggattt
tctactgtctttggagacttggtctcatctgtcttgggaaggcattggaagatttcattg
tttagtgatttttcgctgtccatccttgtgtgctgttttgtatgaatttgatcaaggaaa
EXON 17  142 bp
atgaacaaagagtcatcaaggctaaatacaaatctgtttcattttcatatcttttgcttt
ttctatccattatttttcttgataatggtatcaagacatttgataggtttggatgacagc
aaaaacgtctcctcactatggcctgagctggggagctcatctttctttttctccctccag
GAGAATTCCTGAGTTTTGCTGATGACTTACTCTCTGGCCTGGGCACATCTTGTGTAGCAG
CTGGTCGAAGCCATGGAGAGGTCCCTGAAGTCAGTATCTACTCAGTCATCTTCAAGTGTC
TGGAGCCCGACGGTCTCTACAA
gtaagatgtgttgggtgtgtggggatcatgaggcagacaggatgattttaagcctaagag
gaatggcatgagttattctgtgcaggccagccaaatgttttattagctagcctgtatgtg
caacttgagattctaaggtttagaagtgtccatttgagaagtatgccacaatggatcaca
EXON 18  101 bp
aagaagtgcaaagtgctgagtaggcagttagtgctcaataaatgctttataagtatcatt
ctttttttaaaatcatttttcctgtagcctcatgtgccatgactctctgttcttccctgc
aactcccagggccttctgtgaagtcacagcctggtgctctgttttcttgctgtgctgcag
GTTCACTCTGTATGCTGTGGATACACGAGGGAGGCACTCAGAGCTAAGCACGGTGACCCT
GAGGACGGCCTGTCCACTGGTAGATGACAACAAGGCAGAAG
gtaggtaacccagtttttcaactccaaagtaactcccatatttcccctaagttctgcacc
caacagtcactaatcattaaacacacacacgcacaccctgacacactggcacagggagaa
gaaattgaaggcactaagggaacaggaggaacatggagctaaattaatcaaagtcatgaa
EXON 19  184 bp
gacagaaaaccaaacacaaccagtcaataacatattcaagatgaaattaaggtttgtctg
ctcccagagcttatgcaagcaaactttctcaccactgtgcctttcttattgaagcccatg
cttatatccttactttttttcaccacccagtgatctgtttctgcccttctgccctctcag
AAATAGCTGACAAGATCTACAATCTGTACAATGGGTACACAAGTGGAAAGGAGCAGCAGA
TGGCCTACAACACACTGATGGAGGTCTCAGCCTCGATGCTGTTCCGAGTCCAGCACCACT
ACAACTCTCACTATGAAAAGTTTGGCGACTTCGTCTGGAGAAGTGAGGATGAGCTGGGGC
CCAG
gtatgggcgtatttgtgtgattggaggggcatattctttttgcctccagttgacttttct
ggaccctttccccataggctgagactaggctttatcaagtaaataagggtgattatcacc
ttggtcgtgtcaaggctaaagatagaaaataggcagagataatgaaagaatcttggaact
EXON 20  861 bp
ttgaagaagataggttctagggcaatttttgaatcagtgtttgaagtaccacactccaat
ctggagtagataggaaatggttgggagaagttaccatttgtttgttgacatttactacct
caaaggtctaactcttgatctggacttctttaatcatggctgtctcatcctacctttcag
GAAGGCCCACCTGATTCTACGGCGACTGGAGAGGGTGAGTAGCCACTGCTCCAGCCTCCT
GCGGAGTGCCTACATCCAGAGCCGCGTGGAAACAGTGCCCTATCTTTTCTGCCGCAGCGA
GGAGGTCCGGCCTGCAGGCATGGTGTGGTATAGCATCCTCAAGGACACCAAAATCACGTG
TGAGGAGAAGATGGTGTCAATGGCCCGAAACACGTACGGGGAGTCCAAGGGCCGGTGAGG
GAGGGTATTGCCCTCCGTGAGCACAGAGACTCTCCATGGGAGGGGGAGCAGTATTCTCCT
GGATCCTGGGGCCTGGGTGGGCTGGGGGACAGCTGAGGATGGGCCTAGCAGATGAAGCTT
GCCAGCAAGGCCAAAGCAAACGGTTTCTCCTGTGGATAGTGGACAGAGACCTTTGTAACC
AATGGAATTATTCATTTTTCTCTATCTTTTATTTTTTCAAAGATATTATTTGACTCTATC
AAAAGTCTCTCCTTTTTAAACCTTTTCTTATGGATGGCTGTCAATCCCGAGGCAGAAGTT
TTCAGGTGGAGACCAAGCGGCCTTTGCTCTTCTTCCTTCTTCCTGCCACACTCTGCTTTC
TTCCTGCCATGGACCCCTGGAGGAGACCTATGGAGGGACAGTTTTGACCTGACCCCTAGA
GGAGACAGTTTTGACCTCTTCAGCACCAGGAAGGAAGCTCTGAGGATGGTTGCAGTGAGG
AAGCATGGGTCTTTAAGGACTTCTCTCTCTTTTTTGCTGGACATTATTGAGTTTGTGGGA
CCCTGCCTCTTCCTGCTACCTGTGGGTCTGCCCAGAGTCCCTGCAGGCCTGTCCATGCAT
TAAAAATTCCTATTGTCTCTC
tttctgcttgggtggtatttcttaccaagggaatgtgcttgagagacctctgtttattca
cttattgagtatctaccctgtgccagtcacagagcatatgcaactaaagacagagaagct
tccttccctcagggaacttattgcccagtggaaattatagagaaggagtctggtcatttc