--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (24599 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2256       2366   0    Initial    111    71        Good
gtggatactattatgatcctattttacaaatgagaacactgaggcctaacagattaggtc
agctttggtcagtttcctggcaaatatgcccttaaactatctcatgtgatgaccttttgt
ttgcggttttacagcttaagaaggtggcaaagctgaatcaggcaagtgagaagttcaaac
ATGACGACAAAGGAGGAGGCTGTGAGAATAGCGAGGAGAGGCTGTGGCCGTGGAAAGGCC
AGCCAGGAGGTGGAGGAGCAGAGGTTCACTGGTTTTACCATCAAGCGGATT
gtcagggttcagctcaggctctggtagtgggtctcctggtttcccctctccctccttcca
aaacctggcagaggagggagctgattggaagttggagggctgaggcctgaggcctaagtc
ctgaagagcttctactcagctctgctcctgactcactctaccttgaccaatccacatgcc

Exon  2 +       3562       3649   2   Internal     88    79        Good
caaactaccaaaaaatgtgggatactcggcagttttgcgatttaggaactgtggctctgg
gattgtggacgtacatgatcaccaccctgctgatagttgaggcttctggagctgtcagga
gagtggatggtgcagggagctgtagtgcctctctccaaggctttgtccatgtttccccag
GAATGGCGAGGATCAGATCTGCCCCAAATGCAGAGGGGAAGACCTCCAGTCTATAAGCCC
AGGAAGCCGTCTTCGAACTCAGGAGAAG
gtacgttggcacatcacagaaaggcatttgtccgttgtcttgatttttccaggttgaagc
caagtagacagctgcccactccacccctggcaggcacctcccaactagtcctgagtccag
actgaatttgctttataaggaataaggagactgatgttcacagtggtgaagtgtcttgcc

Exon  3 +       9641       9756   0    Initial    116    45    Marginal
ctgatttgggtgggggttgctgagcccataacaatggcaaaacagactctgcagacacga
ttaaatgaaggattctgagatggggaggtgaccttggattatccaggaggcccaagtgtc
ctcagaagagggagatgagggtcagagagaaggggagatgctccactgctggctttgaag
ATGGAGGAAGGGACCACAAGCCAAGGAGTGCAGGCAGCCCTGAGAAGCTGGGGAAGGGAG
GAAGCCATCCTCCCCTTGGGCCTCCAGGAGCAACGCAGTCCTGCTGACATTTCCAT
gttaggacccctggcctccagaactgtacgataataaagctgtgttgttttaagctgtta
agtttgtggtattttgttacagcagcaatgggtaactaataccagtgcttacatgtatta
tctcatttaatcctcacaataaccctgtaagggggtattattattatccccattttgcag

Exon  4 +      13616      14026   0   Internal    411    90   Excellent
tcatcgtgggcatgtctgatgccagggtcttcctctgaatccctcccactgtacagaaag
ccactcctttttgctgggtgaatgaataatccttggtgacctttgatagcagggcactcc
actgctcccctgtcctcactccacctctgttttcactgatcagccccactctcttgtcag
GGAAGCCCACAGTCTGTGCAAGAGCATGAGGTCACCTCCCAGACCTCCCACCTAAACCTG
CTGTTGGGGTTCATGAAACAGTGGAAGGCCCGGCTGGGCTGTGGCCTGGAGTCTGGGCCC
ATGGCCCTGGAGCAGAACCTGTCAGACCTGCAGCTGCAGGCAGCCGTGGAAGTGGCGGGG
GACCTGGAGGTCGATTGCTACCGGGCACCCTGCTCCGAGAGCCAGGAGGAGCTGGCCCTG
CAGCACTTCATGAAGGAGAAGCTTCTGGCTGAGCTGGAGGGGAAGCTGCGTGTGTTTGAG
AACATTGTTGCTGTCCTCAACAAGGAGGTGGAGGCCTCCCACCTGGCCCTGGCCACCTCT
ATCCACCAGAGCCAGCTGGACCGTGAGCGCATCCTGAGCTTGGAGCAGAGG
gtgagtgtgggaggcaggtttgccttcaagcccggctgagccccatcctgtctccagagc
ggcagacaggcttcctcctaatcattcatcctgcttacagcagtcactccatcaaaacgt
atctcccctttatcccacacccttccaggaagagcgctgagttagaagctgtagtcaagg

Exon  5 +      15064      15133   1   Internal     70    74        Good
gttggtcaggctggtctcgatctcctgacctcgtgatccacctgcctcggcctcccaaag
tgctgggattacaggcataagccaccgcgcctggcctatacttttcttaatgtagccaat
gaccattctaatgttgcttcttttgcagtaacattacatcattgtctcatattgagttag
GCCTGGATTTTAGTTCCTGCTTCACCATTACCATTATCTGCCTCACCATTCGCAATTACC
ATTACAGCAG
gtgatcagagccacctgccgtgtgggtctgagcaagtcactttccctctcaggaccttcc
ccatcagtaaaattaacgattaaattttctttaaggatgctcacttccattcatggcttc
cctacctgagcacacccaagaataaatttatattctttccattttattggggaaagctat

Exon  6 +      15841      16018   0   Internal    178    96   Excellent
cctggtggataaggaaaaggaaggccaggcagggggcagcacattcagatgcagacgcac
acctgagtgaggcgtggtcagcaaaacacatctggggcagatcaatctccacatcccgcc
attcccatcccatccccaagccgggttctggtgttcctggctgaacagtcttccctacag
GTGGTGGAGCTTCAGCAGACCCTGGCCCAGAAAGACCAGGCCCTGGGCAAGCTGGAGCAG
AGCTTGCGCCTCATGGAGGAGGCCTCCTTCGATGGCACTTTCCTGTGGAAGATCACCAAT
GTCACCAGGCGGTGCCATGAGTCGGCCTGTGGCAGGACCGTCAGCCTCTTCTCCCCAG
gtaacacctcccaggggcacagagacctgcctggggaaacaggccccacaggacccagga
agcaagcagtgaaaactgccagctctgtgacagacacgctgtgtccagtttaggccagtg
cccattcaggccactcaccatgggcaggaaccatgctgggatcttcaggttggtgggtga

Exon  7 +      17976      18124   1   Internal    149    98   Excellent
agctagatgacccccaagagcccattcctgtctgacaccctactcgagaagaatgctggg
ttctaaccccatctttcatggttttgagccgctgaccttgggcatgcctgaccactggat
cccagtcccacatctgcaaagtccagcacttcccaactgcctctggcttctgcgtttcag
CCTTCTACACTGCCAAGTATGGCTACAAGTTGTGCCTGCGGCTGTACCTGAATGGAGATG
GCACTGGAAAGAGAACCCATCTGTCGCTCTTCATCGTGATCATGAGAGGGGAGTATGATG
CGCTGCTGCCGTGGCCCTTCCGGAACAAG
gtatgggtgtgaaggtgatgggggtaaggtggggagcatggaagcctgagtcctagtcct
ggtttggcaatgaattggccatgtgacctggcaagtcccccaccctctctgtgttatcag
tttccctttttataaaacaatcagatctagtaactagggctccctccagctccatgagtc

Exon  8 +      22116      22334   0   Terminal    219   100   Excellent
gtctggccatacgccaggtgcgctccttacttggtttctctgactcctaatccaaatgag
ccaagggtctgaggggctgcacaggcagtaggtgtggagcacagctctgagcccaagcct
gggcctccaagctgcgctgctgctgtagggcctgatctcccacctatcccttccctgcag
GTCACCTTCATGCTGCTGGACCAGAACAACCGTGAGCACGCCATTGACGCCTTCCGGCCT
GACCTAAGCTCAGCGTCCTTCCAGAGGCCCCAGAGTGAAACCAACGTGGCCAGTGGATGC
CCACTCTTCTTCCCCCTCAGCAAACTGCAGTCACCCAAGCACGCCTACGTGAAGGACGAC
ACAATGTTCCTCAAGTGCATTGTGGAGACCAGCACTTAG
ggtgggcggggctcctgagggagctccaactcagaagggagctagccagaggactgtgat
gccctgcccttggcacccaagacctcagggcacaaagatgggtgaaggctggcatgatcc
aagcaagactgaggggtcgacttcgggctggccatctggttaggatggcaggacgtgggc

--------------------------------------------------------------------------------