--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (19758 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (14 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        300        434   0     Single    135    74        Good
agtcagtacccacccccaggccatccggttttagggaccctggatgtcagaagagtgaac
tgtcatgttttggctagaaaagcctcttagaacacgtctcaggacaactcggtggtggcc
actgcgcagaccagacttcgctcgttctcgcatgcctcgctccgcttttcctccgcaacc
ATGTCTGACAAACCCGATATGGCTGAGATTGAGAAATTCGATAAGTCGAAACTGAAGAAG
ACAGAGATGCAAGAGAAAAATCCACTGCCTTCCAAAGAAACGATTGAACAGGAGAAGCAA
GCAAGCGAATCGTAA
tgaggcgtgcaccgccaatatgcattgtacattccacaagtattgccttcttattttact
tcttttagctgtttaactttgtaagatgcaaagaggttggatcaagtttaaatgactatg
ctgcccctttcacatcaaagaactactgacaacgaaggctgcgcctgcctctcccatctg

Exon  2 +       1201       1361   0    Initial    161   100   Excellent
cccttccaggccaagcctggaaagggacccctgtggtcagtcacccaactcagtatggct
aagccttaccacaggctgtccccttgggatcacagtggcctggctgtctgggctgggagg
taggagacctggagggttgggtgtttgggtccactaactgccctgtgtccgcaggccaca
ATGCTGCTTGGAGCCTCTCTGGTGGGGGTGCTGCTGTTCTCCAAGCTGGTGCTGAAACTG
CCCTGGACCCAGGTGGGATTCTCCCTGTTGTTCCTCTACTTGGGATCTGGCGGCTGGCGC
TTCATCCGGGTCTTCATCAAGACCATCAGGCGCGATATCTT
gtgagtacctggcccagcctttcctggggtctgccacactacagtgagcttctggtcccc
caaatctccccaggccagacctcatgttctctaccagcacagggcagctgagctgagttc
cagaacagcagcctctgctccacacccgtaccctggcaatagtacctggtccctccatct

Exon  3 +       3223       3617   2   Internal    395    85        Good
gtgttattgagaggcatcagtaaggcagtgcatgttcccagcaggagccaggagatagaa
gtgttgtagggggtctggctcatgaagcataggctggcgaggcagcagcctggggtaggg
tgtcaggacccctccctcccaaccatggcagacacagcgccctctcttgttcacacacag
TGGCGGCCTGGTCCTCCTGAAGGTGAAGGCAAAGGTGCGACAGTGCCTGCAGGAGCGGCG
GACAGTGCCCATTTTGTTTGCCTCTACCGTTCGGCGCCACCCCGACAAGACGGCCCTGAT
CTTCGAGGGCACAGATACCCACTGGACCTTCCGCCAGCTGGATGAGTACTCAAGCAGTGT
AGCCAACTTCCTGCAGGCCCGGGGCCTGGCCTCGGGCGATGTGGCTGCCATCTTCATGGA
GAACCGCAATGAGTTCGTGGGCCTATGGCTGGGCATGGCCAAGCTCGGTGTGGAGGCAGC
CCTCATCAACACCAACCTGCGGCGGGATGCTCTGCTCCACTGCCTCACCACCTCGCGCGC
ACGGGCCCTTGTCTTTGGCAGCGAAATGGCCTCAG
gtgagccccaagggggcgggggacaagcaggaaccccatgggatcttacacagaccacag
ctcccttccagccctgccaaggctgtgtgggtcagtggttaagggcacagagtggagtca
gacagcttaggcagtgccacgagtaaacgagatcctggggaagggactgatttctctgag

Exon  4 +       5222       5317   2   Internal     96    75        Good
cagcctggatgacagagagaggttacgtgtcaaaaaaaaagatacttacctgaagcacta
gcaacatggctgatgctaggtggcccctcagtacaatggtaatcatccttgtgactaatt
aggccgtatctagctcatctgtaaaatgggaacaaaattaattccccactttcctcacag
AGCCTGCATTTTATTTGCTGCCACATTGGGCACCTGCAAAGTACTGAGGTTGCTGCTTTC
CAAGAGCAGCTCTAATCTCTATAAAGACCGAGTGAG
gtagggatcttggttttatggatgatgagcctggagttcagaggggtttgtgaggagctc
acccaagatcacacagttagtaagtggtagaactggggtttgatcttcagcttgatcaca
gcactctgttttttctccccacactgttgtggttgtgggataatgaatagggaagtcatt

Exon  5 +       6613       6771   1   Internal    159    95   Excellent
gcccatggctaatagaaccattgccggtgcccctgtcaacactgaaggcccagttgcttc
actgcctctcctcctgcccagccagtatcctcagcaacatggccagccctgctgggagca
gaggtccctgggaacatggggttttctggcctgcctgctgactgccctgtctccccacag
CCATCTGTGAGGTCCATGCCAGCCTGGACCCCTCGCTCAGCCTCTTCTGCTCTGGCTCCT
GGGAGCCCGGTGCGGTGCCTCCAAGCACAGAACACCTGGACCCTCTGCTGAAAGATGCTC
CCAAGCACCTTCCCAGTTGCCCTGACAAGGGCTTCACAG
gtgggctccatcccctccccatagaggggctctcacacaggccctggacagagcactggc
ctcagtgccagaaggaggcttttctggaaacttgccatgtgcctggaacatgtcacgtca
cctccctttttccatctggaaaatggtgacagtaaacctgggccactccagggttactgt

Exon  6 +       8380       8449   1   Internal     70   100   Excellent
ttgttggaatggatgccggtgttagagctgaatggtatctgaggttatcagaacaggctt
cctagcaagggtgtgatgggaacaggtgttgaagggtgcacacctgcaggtgtccatttg
tgtgaccctttgcccagccctgagctgcccccgacagccactcgcgtctgttttctttag
ATAAACTGTTCTACATCTACACATCCGGCACCACAGGGCTGCCCAAGGCCGCCATCGTGG
TGCACAGCAG
gtaaggggcaggtgcccagggtggggtaggcacaggcagggctggggagcctccttctgc
ctttctagggcccgctcagcccttggccctgtgccttcccaggtattaccgcatggctgc
cctggtgtactatggattccgcatgcggcccaacgacatcgtctatgactgcctccccct

Exon  7 +       8552       8643   2   Internal     92   100   Excellent
ttctttagataaactgttctacatctacacatccggcaccacagggctgcccaaggccgc
catcgtggtgcacagcaggtaaggggcaggtgcccagggtggggtaggcacaggcagggc
tggggagcctccttctgcctttctagggcccgctcagcccttggccctgtgccttcccag
GTATTACCGCATGGCTGCCCTGGTGTACTATGGATTCCGCATGCGGCCCAACGACATCGT
CTATGACTGCCTCCCCCTCTACCACTCAGCAG
gtaactctagggctgtcacacagcctccagcacctgccaggtctctaggaaccccacccc
catcaggcagtgtgctgcagtagaaacacacagctttgggccaggcgcagtgactcacac
ctgtaatcccagcactttgggaggccaaggtgggcggatcacttgaggccaggagttcga

Exon  8 +      10706      10815   1   Internal    110   100   Excellent
gagcctggtgatggaagccggggaggcttcttggaggaggtcacccaaggcaggcagatg
tgaggtgcagaagcctgcagggcagcacaagcctgcctggctggatggcagtatcactga
tttggggccggggagggtcttcatctcgctgaccctcaggggccatccctctgcctccag
GAAACATCGTGGGAATCGGCCAGTGCCTGCTGCATGGCATGACGGTGGTGATTCGGAAGA
AGTTCTCAGCCTCCCGGTTCTGGGACGATTGTATCAAGTACAACTGCACG
gtgagcgagagcgggaagggtgagctgtccctttcccctagttaccctcttcccaactac
actccggggcatctgtcttatagctgaggtggccagtcattccaaagggctcatttgtgg
caaagttcccattgttcagatgggaaggctgagacccggagagggaaaggatggcatggc

Exon  9 +      11093      11302   0   Internal    210    95   Excellent
cattccaaagggctcatttgtggcaaagttcccattgttcagatgggaaggctgagaccc
ggagagggaaaggatggcatggccagcccctggggagagtaggggcttgagggatcagga
gaatcctagtgtagtgagggcagcctctggagcctcgaatcacaccaagttcacccccag
ATTGTGCAGTACATTGGTGAACTGTGCCGCTACCTCCTGAACCAGCCACCGCGGGAGGCA
GAAAACCAGCACCAGGTTCGCATGGCACTAGGCAATGGCCTCCGGCAGTCCATCTGGACC
AACTTTTCCAGCCGCTTCCACATACCCCAGGTGGCTGAGTTCTACGGGGCCACAGAGTGC
AACTGTAGCCTGGGCAACTTCGACAGCCAG
gtgcggccaggttggggatgggcgaggctgctgcagggatggcccacagaaggcactgga
tgcagaggggagggcagagttcgagcgtgagagtgtgggtgctggagtcccacttccccc
tcattgtccagttttgggcccatggtgagagagcccaggcccaagtcttggccttcgcag

Exon 10 +      11483      11609   0   Internal    127    94   Excellent
gtgcggccaggttggggatgggcgaggctgctgcagggatggcccacagaaggcactgga
tgcagaggggagggcagagttcgagcgtgagagtgtgggtgctggagtcccacttccccc
tcattgtccagttttgggcccatggtgagagagcccaggcccaagtcttggccttcgcag
GTGGGGGCCTGTGGTTTCAATAGCCGCATCCTGTCCTTCGTGTACCCCATCCGGTTGGTA
CGTGTCAACGAGGACACCATGGAGCTGATCCGGGGGCCCGACGGCGTCTGCATTCCCTGC
CAGCCAG
gtctgccacttcggggtcagagagggaggggttggcctgggaaggaaggaggccaggcgc
gtgtggatggggagccttgttctgaccagtggccatcagttatctctgctcttagggtta
caagttactcatttatttgtgtatccatccattcattcattcattcgccattctatctgt

Exon 11 +      13121      13258   1   Internal    138   100   Excellent
aacccaggaggtagaggttgcagtaagccaagattgcactgctgcactccagcctgggca
acaagagcaaaactccgtctcaaaaaaaaaaaaaaaaaaaaagacgcagggtacacctgg
tgacaggacgggtgggagaggctgcctagggcagatctgaccctgccttccccaccccag
GTGAGCCGGGCCAGCTGGTGGGCCGCATCATCCAGAAAGACCCCCTGCGCCGCTTCGATG
GCTACCTCAACCAGGGCGCCAACAACAAGAAGATTGCCAAGGATGTCTTCAAGAAGGGGG
ACCAGGCCTACCTTACTG
gtgggtccccagcccttcacagccccttcctgagggttgggggaggaggggaccttctcc
cacctccagaggacaccttcccaggactcccccagtcctggcccttgtggtcaaacaaat
ccttgggctccagcaaagcctccctggcttgagccctggtctcagagctggccaggccca

Exon 12 +      13466      13651   1   Internal    186   100   Excellent
tcctgagggttgggggaggaggggaccttctcccacctccagaggacaccttcccaggac
tcccccagtcctggcccttgtggtcaaacaaatccttgggctccagcaaagcctccctgg
cttgagccctggtctcagagctggccaggcccagccctgcctcatccggcccctccctag
GTGATGTGCTGGTGATGGACGAGCTGGGCTACCTGTACTTCCGAGACCGCACTGGGGACA
CGTTCCGCTGGAAAGGTGAGAACGTGTCCACCACCGAGGTGGAAGGCACACTCAGCCGCC
TGCTGGACATGGCTGACGTGGCCGTGTATGGTGTCGAGGTGCCAGGTATGTGCAGGCAGG
CGCGAG
gtgtgggtagggaggcaccacccaggggcaccaccagctactcagtgtctaccctgccac
ccccaggaaccgagggccgggccggaatggctgctgtggccagccccactggcaactgtg
acctggagcgctttgctcaggtcttggagaaggaactgcccctgtatgcgcgccccatct

Exon 13 +      13718      13864   1   Internal    147   100   Excellent
aaggtgagaacgtgtccaccaccgaggtggaaggcacactcagccgcctgctggacatgg
ctgacgtggccgtgtatggtgtcgaggtgccaggtatgtgcaggcaggcgcgaggtgtgg
gtagggaggcaccacccaggggcaccaccagctactcagtgtctaccctgccacccccag
GAACCGAGGGCCGGGCCGGAATGGCTGCTGTGGCCAGCCCCACTGGCAACTGTGACCTGG
AGCGCTTTGCTCAGGTCTTGGAGAAGGAACTGCCCCTGTATGCGCGCCCCATCTTCCTGC
GCCTCCTGCCTGAGCTGCACAAAACAG
gtgtgtccctcccctgctccagctctcggatcccaggtcccttcccgtttccttctggag
agacccggttggctgttacttgacctctgcacacagcctggccgggcagttggtaaagtg
acctgcctgtgtagaggtgagcagacggggctggcagagaagacacacattgttccttag

Exon 14 +      18402      18559   1   Terminal    158   100   Excellent
actttgccacagctgctgtatgaccattctttgcaaactgtaaagggctgtgcctcctcc
cccacttccctcccctgtttgtcctccagccctgctccctgccttcctcagtactggtgg
ttgggaagctgggagctcgggcccctgccctgcactgagtcttcttccctgctctcccag
GAACCTACAAGTTCCAGAAGACAGAGCTACGGAAGGAGGGCTTTGACCCGGCTATTGTGA
AAGACCCGCTGTTCTATCTAGATGCCCAGAAGGGCCGCTACGTCCCGCTGGACCAAGAGG
CCTACAGCCGCATCCAGGCAGGCGAGGAGAAGCTGTGA
ttccccccatccctctgagggccggcggatgctggatccggagccccaggttccgcccca
gagcggtcctggacaaggccagaccaaagcaagcagggcctggcacctccatcctgaggt
gctgcccctccatccaaaactgccaagtgactcattgccttcccaacccttccagaggct

--------------------------------------------------------------------------------