--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (4773 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (2 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2537       3036   0    Initial    500    23        Poor
ttaaatatgtatattcttttttcaaatttgctgttttctaaattttgttgtggaagaatc
aacttatgtacatcaacctgctcccccccttacatcaataaacacactatcctgtgattt
cttgtagtaaaattgcatttataatagtgaaaataagtttgagagtattttcctaactaa
ATGAATATCACACTTTATTCATTTCTTTATGTCCTCAGATTAAATGAAGGGAATAGTACT
GGAAGAAATATAGATGAAAGAAAGAAAATGCAAGGAGAAAACTTCACCATTTGGAGCATT
TTTTTCTTGGAGGGATTTTCCCAGTACCCAGGGTTAGAAGTGGTTCTCTTCGTCTTCAGC
CTTGTAATGTATCTGACAACGCTCTTGGGCAACAGCACTCTTATTTTGATCACTATCCTA
GATTCACGCCTTAAAACCCCCATGTACTTATTCCTTGGAAATCTCTCTTTCATGGATATT
TGTTACACATCTGCCTCTGTTCCTACTTTGCTGGTGAACTTGCTGTCATCCCAGAAAACC
ATTATCTTTTCTGGGTGTGCTGTACAGATGTATCTGTCCCTTGCCATGGGCTCCACAGAG
TGTGTGCTCCTGGCCGTGATGGCATATGACCGTTATGTGGCCATTTGTAACCCGCTGAGA
TACTCCATCATCATGAACAG
gtgcgtctgtgcacggatggctacggtctcctgggtgacgggttgcctgaccgctctgct
ggaaaccagttttgccctgcagatacccctctgtgggaatctcatcgatcacttcacgtg
tgaaattctggcggtgctaaagttagcttgcacaagttcactgctcatgaacaccatcat

Exon  2 +       2537       3574   0     Single   1038    88        Good
ttaaatatgtatattcttttttcaaatttgctgttttctaaattttgttgtggaagaatc
aacttatgtacatcaacctgctcccccccttacatcaataaacacactatcctgtgattt
cttgtagtaaaattgcatttataatagtgaaaataagtttgagagtattttcctaactaa
ATGAATATCACACTTTATTCATTTCTTTATGTCCTCAGATTAAATGAAGGGAATAGTACT
GGAAGAAATATAGATGAAAGAAAGAAAATGCAAGGAGAAAACTTCACCATTTGGAGCATT
TTTTTCTTGGAGGGATTTTCCCAGTACCCAGGGTTAGAAGTGGTTCTCTTCGTCTTCAGC
CTTGTAATGTATCTGACAACGCTCTTGGGCAACAGCACTCTTATTTTGATCACTATCCTA
GATTCACGCCTTAAAACCCCCATGTACTTATTCCTTGGAAATCTCTCTTTCATGGATATT
TGTTACACATCTGCCTCTGTTCCTACTTTGCTGGTGAACTTGCTGTCATCCCAGAAAACC
ATTATCTTTTCTGGGTGTGCTGTACAGATGTATCTGTCCCTTGCCATGGGCTCCACAGAG
TGTGTGCTCCTGGCCGTGATGGCATATGACCGTTATGTGGCCATTTGTAACCCGCTGAGA
TACTCCATCATCATGAACAGGTGCGTCTGTGCACGGATGGCTACGGTCTCCTGGGTGACG
GGTTGCCTGACCGCTCTGCTGGAAACCAGTTTTGCCCTGCAGATACCCCTCTGTGGGAAT
CTCATCGATCACTTCACGTGTGAAATTCTGGCGGTGCTAAAGTTAGCTTGCACAAGTTCA
CTGCTCATGAACACCATCATGCTGGTGGTCAGCATTCTCCTCTTGCCAATTCCAATGCTC
TTAGTTTGCATCTCTTACATCTTCATCCTTTCCACTATTCTGAGAATCACCTCAGCAGAG
GGAAGAAACAAGGCTTTTTCTACCTGTGGTGCCCATTTGACTGTGGTGATTTTGTATTAT
GGGGCTGCCCTCTCTATGTACCTAAAGCCTTCTTCATCAAATGCACAAAAAATAGACAAA
ATCATCTCGTTGCTTTACGGAGTGCTTACCCCTATGTTGAACCCCATAATTTACAGTTTA
AGAAACAAGGAAGTCAAAGATGCTATGAAGAAATTGCTGGGCAAAATAACATTGCATCAA
ACACACGAACATCTCTGA
ttgggtccctatggttttaccagagatgtgcccctggcagagctcatcagagaaattcga
gacaacatacaacctcttagaactctgatcggatcttatctctatataatttcacagtta
tgagctgcatacacagagtgattgcctattaataatagtaggtttcaatttgcatttgtt

--------------------------------------------------------------------------------