--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (13390 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1316       1492   0    Initial    177    78        Good
ccggggaggggcgggcgcctgccgccagggggcgccgcggggcagcggggttgcacctgg
cgcttggcgcccgcacctctgcccgcctcggagaccccgcagccccgcgccgccgcctgg
ccccggccccggcccctccgcgggatcctggcccctcctcgagcgccgccaccggccgcc
ATGGCCTCTCTGGGGGACCTGGTGCGCGCCTGGCACCTGGGCGCGCAGGCTGTGGATCGT
GGGGACTGGGCCCGCGCCTTGCACCTCTTCTCGGGCGTCCCGGCGCCGCCCGCCAGGCTG
TGCTTCAACGCGGGCTGCGTGCACCTGCTGGCCGGGGACCCCGAGGCCGCGCTGCGG
gtgagcggggcgtggggaggccggtgcgggcgacgcctccgcctcgagcccctggggagg
gcccagcgcccctccccgaccgtcacggggtcgccctgccgcccccgacccagcgaacgc
cccggcaggtgggagccgagcaggggggccgcacctgagctaagcgaggccgcgctgggg

Exon  2 +       4034       4116   0   Internal     83   100   Excellent
agtggcgacagccctgcccaggcaggggctccgaaggttcctggacaggagcaggagggg
ctgtggggggtccccaggggctgacggaattccgtggccctgtcacccatcacgctgtat
ctgtgatgctgcgtgaccaggttacagaccttggcatcccgtgggcatttttgtccccag
GCATTTGACCAAGCCGTGACCAAGGACACCTGCATGGCGGTTGGCTTCTTCCAGCGAGGA
GTGGCCAACTTCCAGCTGGCAAG
gtgagtacaggggtgccttgttccttctctgacggccctttgtctccctgcagagtccac
tcctgcacctcctcctcctccctctccatccactccctcctcttgcccaccccctcctcc
atggttcctggctccagggaaacctgagactgtggccctcgcctctgctgagcgccaccc

Exon  3 +       5819       5927   2   Internal    109    99   Excellent
atgtgcatggacccctggcccaccagacctgagtgtgcagacctaggcaccgcactgccc
tccctcaggtctccttggaaccaggtgttgggggcggctcgagcggggctggtgtgaaag
ctgcctaaccacagccccatctccgccctgtgctgctgaggggaccccggctgcccacag
GTTCCAGGAGGCTCTGTCTGACTTCTGGCTGGCCCTGGAGCAGCTGAGGGGCCACGCTGC
CATCGACTACACGCAGCTGGGCCTGCGGTTCAAGCTGCAAGCCTGGGAG
gtgaggccgggcagggctcactgtgctgctggctgtggggtgtccacgggcggtggcact
gtcacaggagggccctgtggactggggagcgcctctggccgaagctcttggtgccatgga
ataccctggccactccttgacccgcaggaggttctggtggcagtggaggtggagggacca

Exon  4 +       6743       6802   0    Initial     60    75        Good
gggaggggctgggtgggcagaccgagggaggagctgggtgggggaaccgggagagggcct
gggtggggcatcaggcccctgccatcaccttggccccactcccaggtgctacacaatgtg
gcgtcggcacagtgccagctggggctctggacagaggcggccagcagcctaagggaggcc
ATGTCCAAGTGGCCGGAGGGGTCCCTGAATGGCCTGGACTCAGCCCTGGACCAAGTGCAG

gtgaggagtgccagcccggtcatggttttgggctggtgcctaccaaagctcctcaagacc
aatttcatgagatgaagaagcttccggagggagatggccctagtgcccagtttcgggtgc
caggcgggggcttcctgtgacctgcgggaagggggtggggggcccaagcggccccttctg

Exon  5 +       7089       7175   0   Internal     87    68    Marginal
ccagtttcgggtgccaggcgggggcttcctgtgacctgcgggaagggggtggggggccca
agcggccccttctgctccaaggcacaggggctctgcggctgcaggcctggttggtcaccc
cgtctgcatctgctggatacccaccccctccagagacggggctcactgccgccacggcag
GTCCCCAGGGGCGAGGTCTTCCGGCCCCACCGGTGGCACCTGAAGCACTTGGAGCCCGTG
GATTTCCTGGGCAAGGCCAAGGTAAAG
gtggggacggcgtcctggggcatggcggctggtgctgagccctcgaactgtgttcccagg
gatggggggaggtgcagtccaggccaccgtaagggccaggagggtagagagtgggcccac
agccatcctcaaactggcgcccacggtaggggggcggtgccccaaatggggctgtgagct

Exon  6 +       8096       8118   0    Initial     23    42    Marginal
atagcgaggtccctgggggggtccctgtgtccctgccacagatagcaaggtctcacgggg
gcaggggctgcagtccgacggtctgggccacgtcacgcccacacttgggtcagagccagg
caacacccctaaagtcacaggaatggggagctgctcacccccaaaggcagcgggcgaaac
ATGGCGGAGAAGAAGAACTCCTG
gtgggcaaagactgggtcacccttggctggccacgccccggactggccacgccccattgg
ctggccacgccccctcggtcacctgcgctgcgccacggccgactcctgggcccagtgcag
ctgcccagcaggggaggcctggggtgggcgaagccgggctctgagctgtgttaatgcatt

Exon  7 +       8570       8629   0   Internal     60    90   Excellent
gatgtttttctccatcagacatttccctccatggtggtctggcagacgtgggccgggcat
gggcagctgtcacccagcccccggggacttagagctgcggggcacggtggggcgggctgc
agggagcagaccctgctgggccgctgatccctgacccagcgtccccactgtccccgccag
GTGGTGGCCTCTGCCATCCCCGACGACCAGGGCTGGGGCGTCCGCCCTCAGCAGCCACAG

gtgggtttgcggcccctcagacccctgcctggcctcacccagctttctgggaaagaaaat
gctgcacaagctctgagccctcctggggctgcgaagttcctctgatgggaggtgtggggt
ggccatcccatccctgtgtaagacctggggaaaccactcttcaaggttcaggaggaggga

Exon  8 +       9022       9131   2   Internal    110   100   Excellent
tgttgctttgtgtccacagggaccaggagcgaaccatgatgccaggtaggaggggctgac
tgggccctgcgagcgcgtgcctttcctgctgggcagaggccctccacatggggccacgcg
ggccgggcacaggagggcagtcagatgggcagggcctgagagcctccctcctctccctag
GTCCCTAATCATGGACTCCCCAAGAGCTGGCACCCACCAGGGCCCCCTCGATGCAGAGAC
AGAGGTCGGTGCTGACCGCTGCACGTCGACTGCCTACCAGGAGCAGGTGC
gtgggcctgggcctcttcccctgctgggggtcggtgcttctgctgcctccgcagactggg
gaccacaatgggaccaacatgagggtggagggagcagctcgctggggggtagacggggcc
gggctcacccgtggtcctggcccagcccagccagatgggaggatgcctggctgtgcccga

Exon  9 +      11550      11650   1   Internal    101    61    Marginal
ccaggcccagcttgggcaactcaggtgggccagaaagcccccggtggctgcggtggagct
gggcaccgccccgactgaggcagctgctggaagagggggtggcagaggtcactgccctcc
ctgcaggccccacccaggaggccccctctgaggaatctctttgcagttacctagccccag
GTGAGGACGGGCACTGGGTCCCCATCCCCGAGGAGGAGTCGCTGCAGAGGGCCTGGCAGG
ACGCAGCTGCCTGCCCCAGGGGGCTGCAGCTGCAGTGCAGG
gtgagccaagggcgaggcaggggcaggggcaccctgaggggcggtggaggcccctcctcc
cagtgcccggcccgacctgcagcccactctcctgcctcagggagccgggggtcggccggt
cctctaccaggtggtggcccagcacagctactccgcccaggggccagaggacctgggctt

Exon 10 +      11733      11865   0   Internal    133    80        Good
aggacgggcactgggtccccatccccgaggaggagtcgctgcagagggcctggcaggacg
cagctgcctgccccagggggctgcagctgcagtgcagggtgagccaagggcgaggcaggg
gcaggggcaccctgaggggcggtggaggcccctcctcccagtgcccggcccgacctgcag
CCCACTCTCCTGCCTCAGGGAGCCGGGGGTCGGCCGGTCCTCTACCAGGTGGTGGCCCAG
CACAGCTACTCCGCCCAGGGGCCAGAGGACCTGGGCTTCCGACAGGGGGACACGGTGGAC
GTCCTGTGTGAAG
gtagggtgggcatggcccttcccaggcagcaccgtggtgcccggggtgtggggggcttag
agctcggcctgtgctgtgagcagacgtggcacccagaggccacgcctgggtaacgccctg
cagagcccgatgtcccccttgcagtggaccaggcatggctggagggccactgtgacggcc

Exon 11 +      12704      13038   1   Terminal    335    48    Marginal
gaggtcatgcagcctctgtggccagcaccaccctgacggtgccctggaggtggctgtcac
ctgaccgtgggcagagccacagagcaaggccccacggcgctcagggctcaggaagcctcc
agcatccgggacgcagctgcctgtgggctctgtgggggcccacctccgccttcccactag
TCCTGCAACCAGAAGAGCTGGACCAAGGCAGCCCCCACCACCGCCACCAGGGCCAGCACC
ATGAACACCACTTTGGCCACCCAGACGCCGTAGCTCTCTGCCCGCCACTGAGCCGGCGCA
TCGGCCGGGATCATCCCGGTCAGGTTCAGCATGTAGCCCAGTGTCCAGCCAATGTCCACA
CCGCCCGCCTGCGGGACACACGGCTGCTCAGGGCTGCGGGGCAGCTACCCCAGGACCACG
ACCTGCCCACGCCCACGCCCCGCCCACGCCCAGGGGAGGCAGTCACCTGCTTTCGGAACT
CGAGGCTGGGCCAGGTCTCCTCGCTGAACCCGTAG
ccctcgtgcaggagggtgaggatgtacaggcctgaggcacagtagtcccgcagccagcgg
tcctgcccagggtagctggcctccacctggggcccaggagaccaagaggcgaggtgaggg
cccctgatccccagtcatgcggggaccgccccatctgtcctggccaacctgagcacgcag

--------------------------------------------------------------------------------