--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (90476 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (13 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1770   0     Single    570    91   Excellent
cgcaccgagccgagccggcggctgaggagagccaggcccgatgtggcgggggctacgcgc
cgcggccgagccgtgaggaagcggctcgcgctcacgcgtcccccagcacctcgagcggct
gttccacaccgcccagcctaggcctgccggggcatgagtgtgcccgggacgccgggagcg
ATGGAGCCGGCTGGGGAGGAAGAGCGGCCGCCACCGGCGGCCGAAGGAGAGGACGACGAG
GAGGAGGTGGCAGCGGCGGCCCAGACCTCAGGGCCGGCCCACGGAAGGAGTGCCTCCTCG
CTGGAGGACGCGGACGATCAGGAGGAAGAGATGGAGGCGATGGTGATCGGAGGCGGTTGC
TGCAAGGAGCAGGAGCTGACCTACGAGCTACAGCAGGGCTACCGCATCCTGGGCGAGTTC
CTGCAGGAGAAGCACCGGGGCCTCACCGCCCCCTTTCTGCAGCCCTTGGGGGGCGTTGCC
ACCGCGGAGGAGGAGGTGGCGGAAGGGCCGCGCAGCGGGGGCCGGGGCGGTCGCGCCTTC
CCGCAGCAGCCCGGACAGGGCATGTGTCTGCTGCAGATGGAAGAGAAGTTCGCCAGCGGC
CAGTACGGGGGCATCACCGAGTTCGTGGCGGACTTCAGGTTGATGCTGGAGACGTGCTAC
CGCCTGCACGGAGTGGACCACTGGATCTCCAAACAGGGCCAGAAGCTGGAGATGATGCTG
GAGCAGAAGTTAGCGCTTCTCTCTCGGTAA
gcgagcccggtccccggtgggactgacagactgacacaaacacacactcacacgtgcccg
aggatgggctgggccaggggcctgggggcggcgctgataggtgctgagtcggtgctggag
aagcccgggaggaggagcggcgctgggcggggaccggaggggtgtggtgggtgtgggccg

Exon  2 +      18959      19022   0    Initial     64    68    Marginal
ccggcccaattagctatcatacagatgtatgccattgtatactgaaggatcacagcctaa
aatggtatgctagattagcccaaattcttcagtatttttggaaaaccaatttaacattca
tgcccttattaaagctgaattagttatagtgttatcaccgtataacagagaaaacacata
ATGGTGCTACAGTTTGGTAGAATCCTACACTCATACTGTTCATGGGACCTAGATGGCACT
GAGG
gtaaggttgttacaaagttattctaatttagtgtaataaatcactctggacatagtccaa
ggaggacaggacttcaattattatattttatgtcataaagatttatgtttggctgggtgg
ggtggctcatgtctgtaatcccagcactttgggaggccaaggtgggctgatcgcttgagc

Exon  3 +      21462      21691   1   Terminal    230    65    Marginal
tgttaatgctggtcagaggcaatttataatattttgttgctcttcttgtaataataaatg
taacttgctttgaaatttgtaggattgaaactcagccttgagactttctaccatcatact
ttttccagcagtaattaatttggaaacctgctgtaaagtattttttttttccttgtgcag
AGCTTCACAGAACTACTCCTACTATAGGAAAGGAGGGCTTATGGAAAGGGGTAAAGATTA
ACTTGACAGTAGCGTACAGTAGATTGGAATGGGGAGAATTGAAGAAAAGGAAGGCTTGTA
CGAAGAAGGCTGTAGTAGTCTACATCTCCACTACTGGTCACCACCTCCAATACTGGTCAC
CAGAAATTGGAAGAAATCAGATTGTCCTGAGAACAATTAATAGAACTTAG
tatcttccttggtatagggagaacaaaggaagagacaaagataagtcaaaaagtagttgt
aataatagtagtgatataaacaataagataaaaaaaaagaatggctaatgtttattgagc
gtgagtatttgccaggtttagctctaagcaccttccttgtattcagcatttatcctgagg

Exon  4 +      31750      31925   0    Initial    176    47    Marginal
agggctgttctgccttatgctggcctataccagccatgtacttttttgtccttcctcaca
tctctttagtattcatagtctgaggctagattccataatcctcccctgaaaggtacagtg
tatgaggaacagcagcagtgtgagtagcagcccttgattagcttcagatagtgcacacag
ATGGCATTATCACACTTCAACTGTGTCATGAATTTTCTTCCTCTTCTAGGAGCAAGTCAG
TTGGTGCTAACTTTGGCCTACCAGGCAAACTGTGTTTCTGTCTCTTATACTGACCTGCTA
GGAAAACCTGGGGGAAGTTATTTCACCTTTCTGTATGTCCTTAATATTCGCAGCAG
gtaaataatttgtgaaattaccttatcaccaatctttatattggccaaaagttgcttttc
actgctttaggcaaagcaagtccataaaagttttttcatctactccaactttccctttca
ttttcttccccaagcactagctgtcactctttcacttctgcagaacatgtaacactcttc

Exon  5 +      39525      39632   2   Internal    108    80        Good
agctgagattgcatcactgcactacagcctgggggacagagcgagactctgtctcaaata
aataaataaataaaactaggacagttgattgcctttttggctaaagataaatatacttaa
aatttatcattttatggtaccctctgaataataatagtataatttgttaaatttctttag
GCTTCGGGAGCAGGAAAGAAAAGAAGCAGAAGAAGCTAGTCAAAAGGAAATAGAAGAATG
GGAAAGAAAACTTCTAGCTCAAGCAGCTCCAACTTGTATGGAGACCAT
gtgggaaattccagctattgggcatttcctttgtttagctcagcaaattctaaatttgcc
agaaatagtcttttacgaattggaacgttgtcttctgatgcctcagtgtaatgcttttct
atcgaaaataatgacttctctattaagtcctccccatcgcagacctaccttacatcgaag

Exon  6 +      39525      40977   2   Terminal   1453    80        Good
agctgagattgcatcactgcactacagcctgggggacagagcgagactctgtctcaaata
aataaataaataaaactaggacagttgattgcctttttggctaaagataaatatacttaa
aatttatcattttatggtaccctctgaataataatagtataatttgttaaatttctttag
GCTTCGGGAGCAGGAAAGAAAAGAAGCAGAAGAAGCTAGTCAAAAGGAAATAGAAGAATG
GGAAAGAAAACTTCTAGCTCAAGCAGCTCCAACTTGTATGGAGACCATGTGGGAAATTCC
AGCTATTGGGCATTTCCTTTGTTTAGCTCAGCAAATTCTAAATTTGCCAGAAATAGTCTT
TTACGAATTGGAACGTTGTCTTCTGATGCCTCAGTGTAATGCTTTTCTATCGAAAATAAT
GACTTCTCTATTAAGTCCTCCCCATCGCAGACCTACCTTACATCGAAGACCTACTTTGCC
TTATAGGACCTGGGAAGCAGCGCTGAGGCAGAAAGTACAACAGTGGTACACTGCTGTAGG
GCAAACTGAAAATCCTGATAACTGTGCTGAAAAACTGGGGTTGTGTCCTCAGTTTTTTAA
AGTTCTTGGAGAAGTTAATCCATTGGAAGAAAAACCTTTTCACGAACTACCTTTTTACCA
AAAAGTGTGGCTACTTAAGGGTCTTTGTGACTTTGTGTATGAAACACAAAAGGAAGTTCA
AGATGCTGTACTTGGACAGCCTATCCATGAATGCAGGGAAGTTATTCTTGGTTATGATTA
TTTGGAGAATGCTTATGTACATTTTCCACAGTTCTGTGGTGCAGATGTACGGATTTATAA
ACAGAGACCCTTTCAGGCCCCAGAATTTCCAATTCCACCCATTAAAATACAAAGAGTACC
TCGGATTAAATTGGAGAAATTGAAGTGTGACTATGTTAGTACAAGTAATGGAGAACATAG
ATGTAGCAGAGATAGCCTGCCCTCTTCCTTCAAGAAAGAGCAGGAAAATAATTTTGATCC
AGCTTGCTGTCCTGCTAAAATGATCTTGGATAATCATGACATCTCTGTTGAAATGGGAGT
AAAATCCAACTATGAAATTAGAATTCGCAGGCCTTGTGAAATTAAAAAAACTGATTGTTG
TAAAGAAAATTTAGAGAAACCAAGGAGTCCAGGGGAAGTTACTGGCTTTGGAGAGCCTCT
TAGTCCAGGTGAAATAAGGTTTATAGAAAATCAGGAAAAATACGGTGAAGCTTCCAGAAT
AAAGATTGAACCCAGTCCATTAAAAGAAAATACTCTAAAATCTTGCCAAATACATGTAAA
TGGAAGTCACAGTGATCATCCAGAAATTAACTGCCACAAAGTTGTAAGGGATATTCTATT
AGAGCAGTCACTACAGAGCCACAAGAAACTCAAACTAACTAAAATGAGGGCAAAAAAGAA
GAAAAAGAAAAAAAAGAAATTGAAAGATGTTTTGAATGAAAACTTACAGAGAAAGCGTGA
AGGTCTTCATTCTCTTGCATTCAAGTCTTACAAACCTGAGATCCAGAATAAGTTATTGAT
CATCAAAAAAAAAGCAAAACACAAGAAGCACAAATCTGGTAAGCTAACACAAATGGATGG
GAGTTATATTTAA
gtataattcaaattgttttttccattatgcatcatggatgctttgattgagagagtaaaa
tgcacatgtatgcatgcgtgtatatttgagggtcaaattttattttatattcaatgtgtt
aaaaagccagagcagatgacattttatatacttacaacaaaaaaagtactgatgcagtat

Exon  7 +      46231      46338   2   Internal    108    62    Marginal
tgaaatacgtcccatcaatacctaatttcttgagagtttttagcatgaagggttgttgaa
ttttgtcaaaggctttttctgcatctattgagataatcatgtggtttttgtctttggctc
tgtttatatgctggattacatttattgatttgcgtatattgaaccagccttgcatcccag
GGATGAAGCCCACTTGATCATGGTGGATAAGCTTTTTGATGTGCTGCTGGATTCGTTTTG
CCAGTATTTTATTCAGGATTTTTGCATCAATGTTCATCAAGGATATTG
gtctaaaattctcttttttggttgtgtctctgcccagctttggtatcagaatgatgatgg
cctcataaaatgagttagggaggattccctctttttctattgattggaatagtttcagaa
ggaatggtaccagttcttccttgtacctctggtagaattcggctgtgaatccatctggtc

Exon  8 +      49882      49955   0    Initial     74    83        Good
aggggtaagatgaaggggtagatgataactataacgagacaattctaaatccaggtaagg
attgattatgtgacttttctatcacaatgatagaagaaaattctattttgagagagatgc
tgcaataagtagcagaatttggcaactgattcaatattctaagttaaagggtaaaaagaa
ATGGGTGTTCAGGAGTTACTGAATTATGTGATAGCGTTAAAGAATTACCAGTATGATAAG
AAATTTGCTTATAG
gtaagaagaataaaaggaaaataaactgttttgttaaggtcaaattgcttacttgagata
gaacactccagaaactcctagaatatagttagctcaagacatgcacatttagtaaataaa
agacaagtttaggctctagttctgtgactttacatcccaggcactttgcaaattcactgt

Exon  9 +      54472      54505   0    Initial     34    43    Marginal
taggtgcactttaaagggagatgtttatcttcttttaaaactttgggtattgataccgcc
aagggcagcctattaggtgagtgcagagctaaaggagtagaaaaactttgttacctaagc
tacttaaggggattttcacattaggctggctagagaccatagtcttcagctgtagttctt
ATGCAAGTTCCTGACTGCGAAGTCAATGTTAAAG
gtaaggtttttttccctatgtagtctcatcttaagttgcaaatgtagattttaattaagc
agtagtaatgtgacttttttgcctaatcttgcagtagattctaccgtataacacattgga
gatggtaatcgttcagttcatataaacataaaacagcatttgttaatatgtctgttaaca

Exon 10 +      69073      69246   0   Terminal    174    92   Excellent
aattcagaatacaataataatacttctcttacctaaccaaagggtgtacattagctagac
tgaatattagagaagtcagaagcttagatcagagatgctaactcccccagttttttggtc
acagagttctgtataagccagtggttatcaatcaggaatgattttgctccccttccctag
GACACATTGATTGTCATAGTTGAAGAAGTGGCACTGGCATTTAATGGATTGAAACCAATG
TTGCTGCTGAACATCCTACACTGTAATGATCCTACAGTGCACAGACATTTCTCCACAACA
AAGAACTGTCTTGTCCCAAATGTCAGTTGTGCTGAGGTTGTAAAACCCTGGTAA
aagcctgtatttgctaagggccttattctttcattctgtccactgctgccaacttacttg
gagagaaaacaagttgatgttttgaaagttaggtagaaatcactgaaatcataataccag
atcccatcatagagagaattctattacataatatacttctaattaagacttgtacttgat

Exon 11 +      79953      80188   0    Initial    236    71        Good
aagggatttactttaaacattatttttagggaaaatggtatcatcggaggcaagctgtaa
aagaattacatagtacattgatacgtcttttaaatgaattgctgccatgggaaccaaagt
taatgaaggctttccaaagaaacaggtaattttaatgttataatctgttttacttatttt
ATGGTCCTTAATTTACGATTTTTGGATGATGTCCTGGAATCATTTAGTAGTTTTCCAGTC
ATTTGTAATTCGGCAGATATTTTTGACTGCCCACTGTGTGCAAGGCTCTTTCTAAGCCCT
GAGAAAATATTGTTGACTAAACAAAGTCTCCACTCTGTGACTTACATTCTCATGGAAAAA
AACACACTCAAATGTCAGATGGCAAAAAAAAGTGCTGTGAAGAAAAATAAAGCAAG
gtaagggggttaagaaatggctgatttgggcagggtgaaggttactctttgatcaggtgt
cagggaaagcttccctgatgagttggtgtttgaacagagaccttaaagaaatgaggaagg
gagctctgtggatttctgaggggaaagcagagggaatagaaggtactaaagccctagagt

Exon 12 +      84116      84303   2   Internal    188   100   Excellent
tctgtcttcctgagcattggcaagactgaactaagcatcttagacacacttaagattaaa
gcatttctagtgacttaataaaaaatatttccatatgtagtttaaaatgttaaaagttag
tttagattccaagaatttaaatcatatgtattatttattatgttgggcattttatttcag
GAGCCGCCTGAAGAAAGACTATGATGATTTCAGAAGACAACCTGATCATGATACATTTAA
TAGAGAACTATGGACCACTGATGAAGGTGAAGGAGATCTTGGAAAAGACTCTCCTAAGGG
AGAAATCAGTAAGTCTATAGACTCAACAGAACCTCTGGATATCCTGGAGAAAGATCACTT
TGATTCAG
gtaagcattaaactttttttttaagtcaacactgaaggcacaaagagaagtttttgtttg
ctgtgaaggcaaaagataatatggtcaatgaaatatattgattagggaaatctgttatgt
tttgaagaagtagtgtccacatccttataagaagtttctactagcctaggcaacatagcg

Exon 13 +      86917      86996   1   Terminal     80    61    Marginal
cagactgctgattcttctgaagcaaagcaagagctgaaaactgtgtgcataagagattca
cagtcaattcttgttaggacacgaggtgggaacactggagttgtaaaagtacagaccaac
ccagatcaaaattcacccaatactgtatcttcaagttcagttttcacttttgctcctcag
CTGCAGGCATTTCTGGTGCCAAAATCAACAACTTCTTCCTCTGCTTTTTCACCTGTAGCT
GGAACAACTACTACATCTAG
tctttcaccttttagccaaacaccaacttctgtttccattccagctagctttgccccatc
catggggaaaaatctcaaacttacattaggccacaccactggcagtggtgatttgggcca
cgtgatagataaaacttcacacatgccctcttctcccttgaagtcctctatttgttctag

--------------------------------------------------------------------------------