--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (43793 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1393       1571   0    Initial    179    76        Good
acggcgcggcggcgctgcccgcgggaactgcggcgcggccgggaggcgctgttggtgctc
ctggcgctactggcgttggccgggctgggctcggtgctgcgggcgcagcgtggggccggg
gccggggctgccgagccgggacccccgcgcaccccgcgccccgggcggcgcgagccggtc
ATGCCGCGGCCGCCGGTGCCGGCGAACGCGCTGGGCGCGCGGGGCGAGGCGGTGCGGCTG
CAGCTGCAGGGCGAGGAGCTGCGGCTGCAGGAGGAGAGCGTGCGGCTGCACCAGATTAAC
ATCTACCTCAGCGACCGCATCTCACTGCACCGCCGCCTGCCCGAGCGCTGGAACCCGCT
gtgagtgcacagctctggggaggaagcccgccctcagagccccgggcctcagtttctcca
tcagagcagtggcagggcggggagctggggtctccaggatggcgcgtcttattgagtctt
tctccgaagacgatagtgtaagagctcacatgggggcggggaggcaagaaagtaaaaaag

Exon  2 +      16758      16927   2   Internal    170    53    Marginal
gttaggacctttcttggagtctgctggggctcctagtgccacaaggggagctctggaaga
tccttcagtggattatgtccccttccgcaggggaccatgacctatgtcccctttgtcact
ccatccccagtgccagcctgggctagatcctgagttcctgaagttccgctgtatttgcag
GTGCAAAGAGAAGAAATATGATTATGATAATTTGCCCAGGACATCTGTTATCATAGCATT
TTATAATGAAGCCTGGTCAACTCTCCTTCGGACAGTTTACAGTGTCCTTGAGACATCCCC
GGATATCCTGCTAGAAGAAGTGATCCTTGTAGATGACTACAGTGATAGAG
gtgagtcccggccagggctctgggaagagcctgtccttctgtagcagtgtctgggaggtg
agagtgggatgcaggagggctaaagtaggcccagtaaggatgggcttcctgtatcctcct
gtacccaaggaagacctcagggatagtagcccagaaacagtaggcgtgggaaactggaag

Exon  3 +      20170      20443   1   Internal    274    81        Good
gaagtgtacaattcaacgtgcatgtgtttagatggggagcaaatggtggttctggaattc
ctcccccagcctcctcctggccttcggagcacttccaaccttggttctgggtgaggtaag
gatgtcccaggtggcagagcaaaggaggctcctgtctatttcatcttctgtttgggacag
GGAGGCCCAGAAGGCCCCGGGTTGGGATGAGGCGCTCCTCCGAGATTGTCACGGTGACCC
CTGTTGCTTTGTTTGCCTCCCTAGAGCACCTGAAGGAGCGCTTGGCCAATGAGCTTTCGG
GACTGCCCAAGGTGCGCCTGATCCGCGCCAACAAGAGAGAGGGCCTGGTGCGAGCCCGGC
TGCTGGGGGCGTCTGCGGCGAGGGGCGATGTTCTGACCTTCCTGGACTGTCACTGTGAGT
GCCACGAAGGGTGGCTGGAGCCGCTGCTGCAGAG
gtacgtgagccgcccaccatgggagagacagcatgttacctggagtaggtagcatgagga
acagactcatcacgtcacttgagggttaacgggttgcctgggctcagctgcttctctgtc
actgggcaggagagcagtccctgcttagttcggctgttgagaccgttaaatgatttagtg

Exon  4 +      25274      25459   2   Internal    186   100   Excellent
gtggtcacctgccagggctctgacacggctgcagacacctggaataagagaagcaggtct
ttctcagatgttcctccctcttattggaaggaagacaagaattcacccttgaatttccca
attgtcttcctgctgcccgtctgcataggagagacggatggatgtcttgggtgctttcag
GATCCATGAAGAGGAGTCGGCAGTGGTGTGCCCGGTGATTGATGTGATCGACTGGAACAC
CTTCGAATACCTGGGGAACTCCGGGGAGCCCCAGATCGGCGGTTTCGACTGGAGGCTGGT
GTTCACGTGGCACACAGTTCCTGAGAGGGAGAGGATACGGATGCAATCCCCCGTCGATGT
CATCAG
gtcaggagctgacttctgggtgacttgttttttaagcatgcctcattgaatctggctgac
ctgtgagcggaggccctcgggaggaatggttagctgtcagcttaactacctcccctcttc
ccacttttttgcccagagtatttgtttatttttattaaacgtgtctgctacacatgtcaa

Exon  5 +      30136      30209   1   Internal     74    87        Good
gtcagtcccagtgtgagatgggctcagatgccttcgcctgttgagtctttgggtgtgctt
ttaatggtctctctgcctcttccttaggtgtcaggctgctctacctgtttctagacgctc
ttcctttcccccttccaaacctcttttcttccttgctgctttcctatcttctgtggctag
GAGATCAGGTAATCAAGCCTGTGTTTTCTGTAATGAGTAAGTGGGTTGCCAGCGAGGTCT
CTGTGGATGCTCCT
gtgagtcaagtgcatgagctttagtgcatggactttggggtcttggttcccacagcttat
atgttttgggggctgctttcttgctctttacccacattctgtgtcatgagtgtgccgggt
aggtggcctcctgcccgatggaggctgagcatcttggcagtgtccatcatgccttgcgtg

Exon  6 +      30474      30650   0   Internal    177    97   Excellent
tctttacccacattctgtgtcatgagtgtgccgggtaggtggcctcctgcccgatggagg
ctgagcatcttggcagtgtccatcatgccttgcgtgtgcctggcctctttgctgcagata
ctatggacccgcagctcatcccctgctcaccacctggcctctccttttctctgtgtgcag
ATCTGGCAGTGTGGTGGGGTTCTGGAAACACACCCATGTTCCCATGTTGGCCATGTTTTC
CCCAAGCAAGCTCCCTACTCCCGCAACAAGGCTCTGGCCAACAGTGTTCGTGCAGCTGAA
GTATGGATGGATGAATTTAAAGAGCTCTACTACCATCGCAACCCCCGTGCCCGCTTG
gtgagttcctcggcccacctgcactccatctggcttcatctgaacaacagcagctaatcg
tggcttccccaacatagtcgatctggttccagaaatagagaataaattgggtgctcagat
acgagtaaggggagaatttattcctccatttataataattatatgcagtcaaatcttctt

Exon  7 +      33504      33635   0   Internal    132   100   Excellent
tagaagctagaattaggtgcaaggatgttttctatcctctgtgctccacacagggcctgg
catgcgacgaatgctccatcaaagctggctggtggttagtaagtgagcatcagtgaacac
aggggctttgaaaggaagcactaggacccatggggtctcactgttttgttgttttctcag
GAACCTTTTGGGGATGTGACAGAGAGGAAGCAGCTCCGGGACAAGCTCCAGTGTAAAGAC
TTCAAGTGGTTCTTGGAGACTGTGTATCCAGAACTGCATGTGCCTGAGGACAGGCCTGGC
TTCTTCGGGATG
gtgagtgagggtggtgggcccacggcaggcagggacttccctggcctctgggtctgctct
gcaaatcctgggcaagaaaggccacgtcatggggagcactggcttcctccactcccaccc
gcctgcccaccccccaccacctttttatccactgcccttctttctccctgtgagcgtctg

Exon  8 +      37598      37711   0   Internal    114    98   Excellent
cctgcagaacaaggaagcacttttaaagctagaaggtgctgtacagaaaagactcttacc
tttgcgtctagctcttgaagcaggctctcctctcatgccaggtaccctccccaagccttg
tgtggcatctgttagtgtctataaatctggactgaaatgccacatttatgttttatttag
CTCCAGAACAAAGGACTAACAGACTACTGCTTTGACTATAACCCTCCCGATGAAAACCAG
ATTGTGGGACACCAGGTCATTCTGTACCTCTGTCATGGGATGGGCCAGAATCAG
gtaggtatgagcctcaaaagaggagaaagctgtgtgttttgttaaaaaaattaaatagtt
gaatttttttcttgtaaaagtaatatttgggaaatataaaaagtagaagcctagggtggc
cagactcagagagaccactgttaaaattaaaatgtgttttcttcccatcattttttacac

Exon  9 +      39479      39625   0   Internal    147   100   Excellent
gtagcggttcactgagggctgtgggatgcggaggaacccatcacacaggctcgtgttggt
ggtgacgcaggtgcatgaccccacccatgctctcgtgatcccaggttcttgtccagcgat
ctttcctcttcccacatcagtggaaaatgttgtgttacatgttggctgccccatttttag
TTTTTCGAGTACACGTCCCAGAAAGAAATACGCTATAACACCCACCAGCCTGAGGGCTGC
ATTGCTGTGGAAGCAGGAATGGATACCCTTATCATGCATCTCTGCGAAGAAACTGCCCCA
GAGAATCAGAAGTTCATCTTGCAGGAG
gtaggtgaactctctccttccttcctgctgacagtccctgggctataagggagagtgtga
gagtcagacgttctctctggcatagtcctggtgaggatcagggatgtggccatgcatgga
caggagctctggaagacctggaacctcagtcccagtgagcctggggggcggtgatggcag

Exon 10 +      42454      42594   0   Terminal    141    85        Good
gtacaagcctggtgctgtgtccccgggacagtcctgagttgctgcgttacacggaagaca
cttacccctcaataaatatttctgaaatggtaaaaatcagaccctgatctctttaaaaca
tgtctttaggaaaaagagacttttctgatgacttgcctgtcattctgttatcttttgtag
GATGGATCTTTATTTCACGAACAGTCCAAGAAATGTGTCCAGGCTGCGAGGAAGGAGTCG
AGTGACAGTTTCGTTCCACTCTTACGAGACTGCACCAACTCGGATCATCAGAAATGGTTC
TTCAAAGAGCGCATGTTATGA
agcctcgtgtatcaaggagcccatcgaaggagactgtggagccaggactctgcccaacaa
agacttagctaagcagtgaccagaacccaccaaaaactaggctgcattgctttgaagagg
caatcattttgccatttgtgaaagttgtgttggatttagtaaaaatgtgaataagctttg

--------------------------------------------------------------------------------