Gene TSTA3 Variant 1
DNA : 4.11 KbNT_023684
mRNA : 1271 bp NM_003313
CDS : 966 bp NP_003304
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  160 bp
ctgagagctcccaggggaacagggctgcgacgagggagtgcctcggtccagctgggtctt
tctggttgccagtggactatgccccactctgagggcctcactctgtgccagttgccacag
aagagtggggctccaaaggatgagagcgtgatgacctcagcctcccactgtttgacatta
CAGGTGCAACTGACATGGGTGAACCCCAGGGATCCATGCGGATTCTAGTGACAGGGGGCT
CTGGGCTGGTAGGCAAAGCCATCCAGAAGGTGGTAGCAGATGGAGCTGGACTTCCTGGAG
AGGACTGGGTGTTTGTCTCCTCTAAAGACGCCGATCTCAC
gtgagtgagcccatccccagatcagcccttcctctccatcctaccccccaccctagaact
aagagttccaggctgggcatgttgctgagtctaacagtagctgtgtttctgggtccttcc
tgccaggtggctggcctggcctgggtgtgcttggctgtgttcctggaaaaacaaacaccc
EXON 2  115 bp
aaaaacaaacaccctcccatctcttcctggaagcctgcaccctcatatcagccaggccct
ggggccaccctcccttttgactgtccctcctgccatagtcccacccagttcctgcacttg
gcacccaaccctggggtgctggttccctccagagcctcctgacagcctggcttcctacag
GGATACAGCACAGACCCGCGCCCTGTTTGAGAAGGTCCAACCCACACACGTCATCCATCT
TGCTGCAATGGTGGGGGGCCTGTTCCGGAATATCAAATACAATTTGGACTTCTGG
gtaagtgagggtggccccagcaagcactggaaaccaggatcccaggttctgggaacttcc
tggcgggcttcccactctcacaggcccacattcccaccccaggaagtccctgaggatcag
ggcttggcacagcctggtgggggcagcccctgagggacccccagtcactcacacttggtg
EXON 3  129 bp
gctggagagcaatggtgtctgtaagcccactgccttgtccggaaacggttaggatgggca
ggcttgggtcctcccagggctgaagggccagggtgtgtctccacttctgcgtctggagga
gcaggtaagggctgggatctggcctggggagcctgaactgtccccgcctcacccctgcag
AGGAAAAACGTGCACATGAACGACAACGTCCTGCACTCGGCCTTTGAGGTGGGCGCCCGC
AAGGTGGTGTCCTGCCTGTCCACCTGTATCTTCCCTGACAAGACGACCTACCCGATAGAT
GAGACCATG
gtgaggggcagggcctggctgtgggtggggccggggagccggtgggcagggccaggaagt
agcggcctctgcctctcccacgcccgcagatccacaatgggcctccccacaacagcaatt
ttgggtactcgtatgccaagaggatgatcgacgtgcagaacaggtcctcgcgcccatcct
EXON 4  74 bp
ggcctttgaggtgggcgcccgcaaggtggtgtcctgcctgtccacctgtatcttccctga
caagacgacctacccgatagatgagaccatggtgaggggcagggcctggctgtgggtggg
gccggggagccggtgggcagggccaggaagtagcggcctctgcctctcccacgcccgcag
ATCCACAATGGGCCTCCCCACAACAGCAATTTTGGGTACTCGTATGCCAAGAGGATGATC
GACGTGCAGAACAG
gtcctcgcgcccatcctgctgaggcccagccaggagtcggggagagggcccccaggggcg
ggtggggccggctggtcgggtcttcgtgccagcctcagtaagaggccagcggcagcctgg
ggtgggatcgcgggcccaggacgagggcaggagacgctgtgcctccgcagggcctacttc
EXON 5  134 bp
tgcagaacaggtcctcgcgcccatcctgctgaggcccagccaggagtcggggagagggcc
cccaggggcgggtggggccggctggtcgggtcttcgtgccagcctcagtaagaggccagc
ggcagcctggggtgggatcgcgggcccaggacgagggcaggagacgctgtgcctccgcag
GGCCTACTTCCAGCAGTACGGCTGCACCTTCACCGCTGTCATCCCCACCAACGTCTTCGG
GCCCCACGACAACTTCAACATCGAGGATGGCCACGTGCTGCCTGGCCTCATCCACAAGGT
GCACCTGGCCAAGA
gtgagtgcgtccgtccgatggggtgcccgggctcagctcgggaggaggtgacccagtgcc
tctgacacctgctccttccccaaatctgcaggcagcggctcggccctgacggtgtggggt
acagggaatccgcggaggcagttcatatactcgctggtgcgtaaaggaaggcacagctct
EXON 6  65 bp
caccaacgtcttcgggccccacgacaacttcaacatcgaggatggccacgtgctgcctgg
cctcatccacaaggtgcacctggccaagagtgagtgcgtccgtccgatggggtgcccggg
ctcagctcgggaggaggtgacccagtgcctctgacacctgctccttccccaaatctgcag
GCAGCGGCTCGGCCCTGACGGTGTGGGGTACAGGGAATCCGCGGAGGCAGTTCATATACT
CGCTG
gtgcgtaaaggaaggcacagctctccccagagaacctgccctattgagccctgggctggc
ccctgctgggctgtcggggaggtggtgcaggagggaggctcctaccagcagagaatctgg
gctgagctccaagaggagccatctctggtcctcgtggaggccccataggctcctgtctcc
EXON 7  71 bp
aggctcctgtctccaggagtcactggcgtagctctgagctccaagggagaaaggagggac
ccctgttccccaggctgagcccccactgaacaaggacagcagtatggactccccagcagg
ggcgtttgggagagggttggctatacccatggtctctgaccctgcctgtctgacctctag
GACCTGGCCCAGCTCTTTATCTGGGTCCTGCGGGAGTACAATGAAGTGGAGCCCATCATC
CTCTCCGGTGG
gtacctcagccctcagcccccttcctccatggtaggacaggatccaaggttgtcctggga
ggctggctgaggggtgggagcaggaatattcatgggccgtcgggtggcaccaaggggagg
cctgacccggtggctccccacagtgggcgaggaagatgaggtctccatcaaggaggcagc
EXON 8  77 bp
acaatgaagtggagcccatcatcctctccggtgggtacctcagccctcagcccccttcct
ccatggtaggacaggatccaaggttgtcctgggaggctggctgaggggtgggagcaggaa
tattcatgggccgtcgggtggcaccaaggggaggcctgacccggtggctccccacagtgg
GCGAGGAAGATGAGGTCTCCATCAAGGAGGCAGCCGAGGCGGTGGTGGAGGCCATGGACT
TCCATGGGGAAGTCACC
gtatcctctggctccagtgctgggggttgggcgggggccccttgggcgggctcagtggcc
acccggtgtagggccagcgtgggtgggacactgcggagggaggatgctcaccctggcagg
cggaggagctctgctgtggctcccctgggaatggcagaggttcaagggcaagctgcgggg
EXON 9  100 bp
ggctcagtggccacccggtgtagggccagcgtgggtgggacactgcggagggaggatgct
caccctggcaggcggaggagctctgctgtggctcccctgggaatggcagaggttcaaggg
caagctgcgggggctggggtggaggtgctcttctcgctgtggccttgacaaagcctccag
TTTGATACAACCAAGTCGGATGGGCAGTTTAAGAAGACAGCCAGTAACAGCAAGCTGAGG
ACCTACCTGCCCGACTTCCGGTTCACACCCTTCAAGCAGG
gtgagccctgaccccacagccctccacttggtggaggcctgccccagcccctccctcatg
ctcgctaccagggcagaggtgaggtgccccctcagagcctgtactgccctggaggtggga
caccaaagctctgaggggtgacttccctgtccctgggcctcctccccccacttcctccca
EXON 10  346 bp
ctccctcatgctcgctaccagggcagaggtgaggtgccccctcagagcctgtactgccct
ggaggtgggacaccaaagctctgaggggtgacttccctgtccctgggcctcctcccccca
cttcctcccatgcggccccgaccctccctgtccatggccctcacctgcctgcctctgcag
CGGTGAAGGAGACCTGTGCTTGGTTCACTGACAACTACGAGCAGGCCCGGAAGTGAAGCT
GGAAGACAGGATCAGGTGCCAGCGGACCATCGGCTGGCAGAGCCCAGCGGCCACCACCCG
TCAACCCTGCCAGGAGCTGAGGGCACCACCCAGCAACCTGGGCCTGCATTCCATCCGCTC
TGCAGCCCCAAGCATCTTTCCAGTGGGGCCCCCATTCACGTTGGTCCTCAGGGAAACCAG
GGTCCCGGGCAGGCCCGGCGCTTTGCTCCCCACACCAGCCCCCTGCGCGTGTCCACTCTG
ATCCTGCATCCCACTCCCTGGGAGCCAATAAAGTGCATTTTCACAG
gcctggccttggcagctctgtgctgagccgtcccccacacccagggactgccccctagcc
tggccagtcccaggacccactatccccctggcttactgttcagcccccaagagctggtga
ctccctggggtggaaaggccgcagaggctggagatgggaaggcacacgtgggcaggcagc