Gene TRPS1 Variant 1
DNA : 260.53 KbNT_008046
mRNA : 10017 bp NM_014112
CDS : 3846 bp NP_054831
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  484 bp
accgcgccgctctcatttgcggcgctccgactcgggcgaagttctcgcgcagccggctcg
ccgcggccggggccggtcccggcgggcggcggcggcgggtgctcggagccgggcggggcg
gcggcggcggcgcggggacgcgcgctgtctctttaagggagctcggtctggggtggcgct
TTCCTCCGCGAAGGCTCCTTTGATATTAATAGTGTTGGTGTCTTGAAACTGACGTAATGC
GCGGAGACTGAGGTCCTGACAAGCGATAACATTTCTGATAAAGACCCGATCTTACTGCAA
TCTCTAGCGTCCTCTTTTTTGGTGCTGCTGGTTTCTCCAGACCTCGCGTCCTCTCGATTG
CTCTCTCGCCTTCCTATTTCTTTTTTTTTTTTTTAAACAAAAAACAACACCCCCTCCCCT
CTCCCACCCGGCACCGGGCACATCCTTGCTCTATTTCCTTTCTCTTTCTCTCTCTCTCTC
TCTCTCTCTCTTTTTTAATAAGGGTGGGGGAGGGAAAGGGGGGGGATGCAGGAAAGACCT
TTTTCTCTCCCCCCCGCAATAATCCAAGATCAACTCTGCAAACAACAGAAGACGGTTCAT
GGCTTTGGCCGCCGCGCCACCATCTTTCGGGCTGCCGAGGGTGTTCTTGACGATTAATCA
ACAG
gtaaggaggggaggcccgagcgggccgcggggccgggggctgcggggggcgcggggggcg
cgggcgcccctcggccgggcccggggcgccgcgacgcgagtgcagcgcccgctcgtgtgc
gcgcaaaatgtgggcgatcgcgagcggggagccctgggaattaaaagtgactttctttga
EXON 2  158 bp
ttctcttgttgctttattaaaaccctggggagggagaggatcttgctccagatttgctca
tgcttttatatctttcaggcagcctatgatgccagcatattaatatattttaggtgtgat
acatgaaaatatgtttacatcatttaggaaggaaaatttttcttttgctttgttttgcag
ATGTACAGATCAGCTCTCAAAATGTCTTCTGTGTCTTCTGAGCGTCTTCTAAGACAATTG
CATTAGCCTCCTGCTAGTTGACTAATAGAATTAATAATTGTAAAAAGCACTCTAAAGCCA
CATGCCTTATGAAGTCAATGCTGGGTATGATTTTACAA
gtatgtgatctattttttcaagtgaaaatgttaactggaaaagttcttggcacacagtaa
aacatcgtgcaatctgttatttgtcttagagataataacttgagggtggctatagtctta
tggtatctaacttacgactcgctaggggagtttcttccacttagaagtatgacaaatgtg
EXON 3  929 bp
aaattgtttgttttagtctcaactttttgctgtttttagaatgggtttttttttttttcc
tagaggaagcatttgattatgcaccttaaaaaactcacataagtaaaatattccagattc
aactgtatctctgtaactttcagataacactgtatctgccttttccctttatctttgcag
ATATGGTCCGGAAAAAGAACCCCCCTCTGAGAAACGTTGCAAGTGAAGGCGAGGGCCAGA
TCCTGGAGCCTATAGGTACAGAAAGCAAGGTATCTGGAAAGAACAAAGAATTTTCTGCAG
ATCAGATGTCAGAAAATACGGATCAGAGTGATGCTGCAGAACTAAATCATAAGGAGGAAC
ATAGCTTGCATGTTCAAGATCCATCTTCTAGCAGTAAGAAGGACTTGAAAAGCGCAGTTC
TGAGTGAGAAGGCTGGCTTCAATTATGAAAGCCCCAGTAAGGGAGGAAACTTTCCCTCCT
TTCCGCATGATGAGGTGACAGACAGAAATATGTTGGCTTTCTCATCTCCAGCTGCTGGGG
GAGTCTGTGAGCCCTTGAAGTCTCCGCAAAGAGCAGAGGCAGATGACCCTCAAGATATGG
CCTGCACCCCCTCAGGGGACTCACTGGAGACAAAGGAAGATCAGAAGATGTCACCAAAGG
CTACAGAGGAAACAGGGCAAGCACAGAGTGGTCAAGCCAATTGTCAAGGTTTGAGCCCAG
TTTCAGTGGCCTCAAAAAACCCACAAGTGCCTTCAGATGGGGGTGTAAGACTGAATAAAT
CCAAAACTGACTTACTGGTGAATGACAACCCAGACCCGGCACCTCTGTCTCCAGAGCTTC
AGGACTTTAAATGCAATATCTGTGGATATGGTTACTACGGCAACGACCCCACAGATCTGA
TTAAGCACTTCCGAAAGTATCACTTAGGACTGCATAACCGCACCAGGCAAGATGCTGAGC
TGGACAGCAAAATCTTGGCCCTTCATAACATGGTGCAGTTCAGCCATTCCAAAGACTTCC
AGAAGGTCAACCGTTCTGTGTTTTCTGGTGTGCTGCAGGACATCAATTCTTCAAGGCCTG
TTTTACTAAATGGGACCTATGATGTGCAG
gtttgtactttgtattgtctctttgtacagaaaaagttattagaaatgaaatgtgaattc
ttatattcatgttaaaaccaaggtcccagtaccagacaggtagcctgctagatctagcag
aagagatggacacactccatagctacttcatacaagtatattcagagttgtctaaagaca
EXON 4  1130 bp
ctgttgagaaatgaagagtgaatttatttggctctgattattcaagtgatttcataataa
gcaggagtactattgtattttttgatgtggaatacttggcagtaccctccccctcccctg
cagagggcccattgaattaatgacaccttggaagtaaagtccatttcttctgttctccag
GTGACTTCAGGTGGAACATTCATTGGCATTGGACGGAAAACACCAGATTGCCAAGGGAAC
ACCAAGTATTTCCGCTGTAAATTCTGCAATTTCACTTATATGGGCAACTCATCCACCGAA
TTAGAACAACATTTTCTTCAGACTCACCCAAACAAAATAAAAGCTTCTCTCCCCTCCTCT
GAGGTTGCAAAACCTTCAGAGAAAAACTCTAACAAGTCCATCCCTGCACTTCAATCCAGT
GATTCTGGAGACTTGGGAAAATGGCAGGACAAGATAACAGTCAAAGCAGGAGATGACACT
CCTGTTGGGTACTCAGTGCCCATAAAGCCCCTCGATTCCTCTAGACAAAATGGTACAGAG
GCCACCAGTTACTACTGGTGTAAATTTTGTAGTTTCAGCTGTGAGTCATCTAGCTCACTT
AAACTGCTAGAACATTATGGCAAGCAGCACGGAGCAGTGCAGTCAGGCGGCCTTAATCCA
GAGTTAAATGATAAGCTTTCCAGGGGCTCTGTCATTAATCAGAATGATCTAGCCAAAAGT
TCAGAAGGAGAGACAATGACCAAGACAGACAAGAGCTCGAGTGGGGCTAAAAAGAAGGAC
TTCTCCAGCAAGGGAGCCGAGGATAATATGGTAACGAGCTATAATTGTCAGTTCTGTGAC
TTCCGATATTCCAAAAGCCATGGCCCTGATGTAATTGTAGTGGGGCCACTTCTCCGTCAT
TATCAACAGCTCCATAACATTCACAAGTGTACCATTAAACACTGTCCATTCTGTCCCAGA
GGACTTTGCAGCCCAGAAAAGCACCTTGGAGAAATTACTTATCCGTTTGCTTGTAGAAAA
AGTAATTGTTCCCACTGTGCACTCTTGCTTCTGCACTTGTCTCCTGGGGCGGCTGGAAGC
TCGCGAGTCAAACATCAGTGCCATCAGTGTTCATTCACCACCCCTGACGTAGATGTACTC
CTCTTTCACTATGAAAGTGTGCATGAGTCCCAAGCATCGGATGTCAAACAAGAAGCAAAT
CACCTGCAAGGATCGGATGGGCAGCAGTCTGTCAAGGAAAGCAAAGAACACTCATGTACC
AAATGTGATTTTATTACCCAAGTGGAAGAAGAGATTTCCCGACACTACAG
gtgaggcatggggggtggggtcgggaggaatatacaaataaaataatagaaaaaatccat
agaaagagggctgaaccgggaattgttgagagtgattccaatgacttggggaagttatag
gagaagaccacataaaagttcatcacagatttgcaggtgatatagttacagctgtgatca
EXON 5  604 bp
tatatagaactgaaaatgcctgttaattacattccagttttggggtgttaagaatattgc
atttctttctacctactatattgcatgagtaggtagaaaattcaggtgcttaaaggctat
taaaaataaaacaacccttcagaacgctgtctttgcagtaactgttttcttcttctccag
GAGAGCACACAGCTGCTACAAATGCCGTCAGTGCAGTTTTACAGCTGCCGATACTCAGTC
ACTACTGGAGCACTTCAACACTGTTCACTGCCAGGAACAGGACATCACTACAGCCAACGG
CGAAGAGGACGGTCATGCCATATCCACCATCAAAGAGGAGCCCAAAATTGACTTCAGGGT
CTACAATCTGCTAACTCCAGACTCTAAAATGGGAGAGCCAGTTTCTGAGAGTGTGGTGAA
GAGAGAGAAGCTGGAAGAGAAGGACGGGCTCAAAGAGAAAGTTTGGACCGAGAGTTCCAG
TGATGACCTTCGCAATGTGACTTGGAGAGGGGCAGACATCCTGCGGGGGAGTCCGTCATA
CACCCAAGCAAGCCTGGGGCTGCTGACGCCTGTGTCTGGCACCCAAGAGCAGACAAAGAC
TCTAAGGGATAGTCCCAATGTGGAGGCCGCCCATCTGGCGCGACCTATTTATGGCTTGGC
TGTGGAAACCAAGGGATTCCTGCAGGGGGCGCCAGCTGGCGGAGAGAAGTCTGGGGCCCT
CCCCCAGCAGTATCCTGCATCGGGAGAAAACAAGTCCAAGGATGAATCCCAGTCCCTGTT
ACGG
gtaggatggtttcatttttaaataattcatttgttttgaagggcaaaaggaggaacacac
attctttctctacaggattgtgttgtgtgtgaagtgaaacttaatgatctgtctcaatct
ggggatttatactcctaaggccaaagtggcagcaagtaactcatgtgtgtttgtgtgtgc
EXON 6  123 bp
ttaattataatgaaaatcagtggtgcctattaaacacaattgaacctgacctcattatgg
gcagtgtggttttatactgtcattgttgctagtttaaagacaaaactcctgggttgattt
ggtctaactccactgatcatgtgactcacctctgaccttggtttttttcccctgtttcag
AGGCGTAGAGGCTCCGGTGTTTTTTGTGCCAATTGCCTGACCACAAAGACCTCTCTCTGG
CGAAAGAATGCAAATGGCGGATATGTATGCAACGCGTGTGGCCTCTACCAGAAGCTTCAC
TCG
gtaagaacttgttccactctttcaggaaaagctttataaagcagtgttggcctggtctgt
ggtgtgataagtcccattccctggcttgcagtgcctgcccccgcagggttgttttaatac
agtcactttgagtgcacatgtgatttatggtgaagggggcttagatgtgatggggagata
EXON 7  6589 bp
gcactttggttacttcctctgatcctgcttagggcaaaaggaggagatttagtaaatcta
cagcagaaagcctatccctgctttgaacttaagcatggtttatatttgtgaggaattttt
aatgcattttaatgtattttttaatgttttccttttatgtattgtatgtgttctctgcag
ACTCCCAGGCCTTTAAACATCATTAAACAAAACAACGGTGAGCAGATTATTAGGAGGAGA
ACAAGAAAGCGCCTTAACCCAGAGGCACTTCAGGCTGAGCAGCTCAACAAACAGCAGAGG
GGCAGCAATGAGGAGCAAGTCAATGGAAGCCCGTTAGAGAGGAGGTCAGAAGATCATCTA
ACTGAAAGTCACCAGAGAGAAATTCCACTCCCCAGCCTAAGTAAATACGAAGCCCAGGGT
TCATTGACTAAAAGCCATTCTGCTCAGCAGCCAGTCCTGGTCAGCCAAACTCTGGATATT
CACAAAAGGATGCAACCTTTGCACATTCAGATAAAAAGTCCTCAGGAAAGTACTGGAGAT
CCAGGAAATAGTTCATCCGTATCTGAAGGGAAAGGAAGTTCTGAGAGAGGCAGTCCTATA
GAAAAGTACATGAGACCTGCGAAACACCCAAATTATTCACCACCAGGCAGCCCTATTGAA
AAGTACCAGTACCCACTTTTTGGACTTCCCTTTGTACATAATGACTTCCAGAGTGAAGCT
GATTGGCTGCGGTTCTGGAGTAAATATAAGCTCTCCGTTCCTGGGAATCCGCACTACTTG
AGTCACGTGCCTGGCCTACCAAATCCTTGCCAAAACTATGTGCCTTATCCCACCTTCAAT
CTGCCTCCTCATTTTTCAGCTGTTGGATCAGACAATGACATTCCTCTAGATTTGGCGATC
AAGCATTCCAGACCTGGGCCAACTGCAAACGGTGCCTCCAAGGAGAAAACGAAGGCACCA
CCAAATGTAAAAAATGAAGGTCCCTTGAATGTAGTAAAAACAGAGAAAGTTGATAGAAGT
ACTCAAGATGAACTTTCAACAAAATGTGTGCACTGTGGCATTGTCTTTCTGGATGAAGTG
ATGTATGCTTTGCATATGAGTTGCCATGGTGACAGTGGACCTTTCCAGTGCAGCATATGC
CAGCATCTTTGCACGGACAAATATGACTTCACAACACATATCCAGAGGGGCCTGCATAGG
AACAATGCACAAGTGGAAAAAAATGGAAAACCTAAAGAGTAAAACCTTAGCACTTAGCAC
AATTAAATAGAAATAGGTTTTCTTGATGGGAATTCAATAGCTTGTAATGTCTTATGAAGA
CCTATTAAAAAAATACTTCATAGAGCCTGCCTTATCCAACATGAAATTCCCTTCTTTTGT
TATTCTTTCTTTTGATGAGTAGGTTACCAAGATTAAAAAGTGAGATAAATGGTCAATGAG
AAAGAATGGAAGATGGTAAACAATCACTTTTTAAAACCTGTTAAGTCAAAACCATCTTGG
CTAATATGTACTGGGGAAATAATCCATAAGAGATATCACCAGACTAGAATTAATATATTT
ATAAAGAAAGAGACCAAAACTGTCTAGAATTTGAAAGGGTTTACATATTATTATACTAAA
GCAGTACTGGACTGGCCATTGGACCATTTGTTCCAAAACCCATAAATTGTTGCCTAAATT
TATAATGATCATGAAACCCTAGGCAGAGGAGGAGAAATTGAAGGTCCAGGGCAATGAAAG
AAAAATGGCGCCCTCTCAATTTAGTCTTCTCTCATTGGCCATGTTTCAGATTTTGACCTA
GAAATGCGAGCTGTGGTTAGGCTTGGTTAGAGTGCAGCAAGCAACATGACAGATGGTGGC
ACGCTGTTTTTACCCAGCCCTGCCTGTACATACACATGCACACCCTCTCTGATATTTTTG
TCCTTTAGATGTTCAAATACTCAGTAGTCCTTTTGTTTGCGGTTTAGATTCATTTTGTCC
ACACATGTACCCATTTTAAAAAACAATGTCCTCGATGCTTCTGTAGTGATTTCATTTTAG
CCAGGTATTTCTTTCTTGTGTGTGATGAACCAGTATGGATTTGCTTTTCTAAGCCTCCTG
TTGGTTACTAATCTCACTTGGCACATTATAACTAAAGGAATCCCCTCAATTCAAAAGCAT
AGATGGATACAAATGTCAGACCGTGGGTTTAATTTGTTTAGAACACATGGCATTTCTTCA
CAAGGTAACCTGCTGTATTTATTTATTTTCTTTTGGTTAAATATAATTTCCAAACTTTGT
GGTCAGGCAGCGTCTAAGGTTACGTTACCACAGACTGACAGTTGGTATATGTACCAGCCA
ATCCCTTCATTAAATGTATACAGATTTAGTTAAGTAGCATTAAATAGGATTCTTAGAAGT
ATGTCCTCATAGAACTTTTAATACTTAAGGCTTTGTAAAAACTATCCATGAAGGGAAAGC
TCCTCAGCATAACTGCTCAGGGAAATAGGGCTAAATAACTGAACATTAAATAATTGGTTA
AAGGTGCTGTTAGTCGAGCCTCAATGCTTGCTACAAGGATGTATGTACAAGGACTGACTT
TAATAATTTGCATTATATTGTCCCAACCAGTAGTTTATTTTTTGCCACGGAGATGTAGAA
GATATTACAAGCTACTGGATGCACTGTCAGATTAACTTATTTCATTAAAGAAGTTGGGAG
AACAAATAGGAAAAAAAAAACTTATTTTTCTAGTAAATATTAATGTATTACATTTCAAAT
AATGGTGCCTGACATATTGAATAATTATTTTCTACAGTGTACGTATGCAACAAAGATATT
CCATCATGCATTAGAGTCAGTTCTGGCTCTGCCTAGCTGTTTACATTTGCAAATGTAGCA
AACAAGGTAATGAAGCAACTATTTCTATTGCAGTAGATATCCTTTTGTGTGTGTGTGTGT
GCATTAAAGTTGTAAACGGTAACATGAAACAAATGAAAGTTCTTGCTATAATGGTATGGA
AAACAAGAAGGAAATGAAAATATTTTTATGCCTACTTAGGAAAAAAAGGGTAGCACTTAT
TCATTCCAAGTACTTTTTTTTTTTTAATTTTTAAGCTCTTAACTCACATTGTTATGCTTA
AGATGATAAACATATATCCTCTTTTTATTGCTTTGTCTATGTTTCATATGAAACATTTCA
GAAATTATTTTGATAAGTGTTGCTGGAATCTGCAACGCTGATTTTTTTTTGCATTCTGTA
GTCGCATTTGCACTCCATTTTTACATTAATTCGCAGTTGCTTTGTATCATTGTTTTGTTT
GGGTTTTGTTTCTTTTTCACAGTGCCGGGTCTTCGTTTCTTAAAGTTGGATGGCAGGTAG
AGTTCAACCAGTTCGTGACTGTTGTAGCGAATGAAGTTAAAAAAATGTCTTTCTGATGTT
GTGTTGTCATTTTCATTTTTGCATTTTTTTGTTTGCATATTAAAAAAAGAGAAAAGAGAA
AGCAAGAGACAGAAATCAGGACTAAGTCCTCTGCTTCAGTTTCATTGTTAACGGGCCTTA
TTCTGATCTCACCTGTCGCGTAGCTCTAATATTCACATAAACTGAAATAAAGAAGTGGAA
TGAGGAGCTTTGACATTCAAATTATGTGATGTAATTTATCTTCCTTAGGAATTTTGATGG
ATGCATCTCAAAATGTATAGCCAGACTTGAGAGGTGACAATTAAAGATCTAAAAAAGAGA
GGAGATTCCCCCAAACAACAATATTTAATTTTCTTAGTAAAAAGAATAACAGAATGCATC
GTGGCAATCCTTAAGCAACATTATCTATGTGGACTGCTTAAATCAGCAAAACACCAGAAG
TTTGGTTAACTTGGGCAATATGACAAGTATTACTTTTTGGGCAAAACTACTCATTAAGCA
ATTTCTCTAGTGTGTCGGACACAAATAGGTTCTTTATTTTTGGCATGTATGCCTTTTTAT
TTTCATTCAATTTTTTTTTTTTCTCAGACAGACATAGTAGTATCAACTAGCATTGGAAAA
TACATATCACTATTCTTGGAATATTTATGGTCAGTCTACTTTTTAGTAAAATATTTTTGG
ATAGCGTTGACACGATAGATCTTATTCCATACTTCTTTATTATTGATAATTTTATTTTCA
TTTTTTGCTTTCATTATTATACATATTTTGGTGGAGAAGAGGTTGGGCTTTTTTGAAAGA
GACAAAAATTTATTATAACACTAAACACTCCTTTTTTGACATATTAAAGCCTTTATTCCA
TCTCTCAAGATATATTATAAAATTTATTTTTTTAATTTAAGATTTCTGAATTATTTTATC
TTAAATTGTGATTTTAAACGAGCTATTATGGTACGGAACTTTTTTTAATGAGGAATTTCA
TGATGATTTAGGAATTTTCTCTCTTGGAAAAGGCTTCCCCTGTGATGAAAATGATGTGCC
AGCTAAAATTGTGTGCCATTTAAAAACTGAAAATATTTTAAAATTATTTGTCTATATTCT
AAATTGAGCTTTGGATCAAACTTTAGGCCAGGACCAGCTCATGCGTTCTCATTCTTCCTT
TTCTCACTCTTTCTCTCATCACTCACCTCTGTATTCATTCTGTTGTTTGGGATAGAAAAA
TCATAAAGAGCCAACCCATCTCAGAACGTTGTGGATTGAGAGAGACACTACATGACTCCA
AGTATATGAGAAAAGGACAGAGCTCTAATTGATAACTCTGTAGTTCAAAAGGAAAAGAGT
ATGCCCAATTCTCTCTACATGACATATTGAGATTTTTTTTAATCAACTTTTAAGATAGTG
ATGTTCTGTTCTAAACTGTTCTGTTTTAGTGAAGGTAGATTTTTATAAAACAAGCATGGG
GATTCTTTTCTAAGGTAATATTAATGAGAAGGGAAAAAAGTATCTTTAACAGCTCTTTGT
TGAAGCCTGTGGTAGCACATTATGTTTATAATTGCACATGTGCACATAATCTATTATGAT
CCAATGCAAATACAGCTCCAAAAATATTAAATGTATATATATTTTAAAATGCCTGAGGAA
ATACATTTTTCTTAATAAACTGAAGAGTCTCAGTATGGCTATTAAAATAATTATTAGCCT
CCTGTTGTGTGGCTGCAAAACATCACAAAGTGACCGGTCTTGAGACCTGTGAACTGCTGC
CCTGTTTAGTAAATAAAATTAATGCATTTCTAGAGGGGGAATATCTGCCATCCAGTGGTG
GAAATGTGGAGTAAAGAAGCTGGTGGTCTGCTTCTGTGCTGTATGCCAGCCTTTTGCCTT
AAGTTGAGAGGAGGTCAACTTTAGCTACTGTCTTTGGTTTGAGAGCCATGGCAAAAAAAA
AAAAAGAAAAAAAGATCAAGTCGTCTTTGGTGAGCCAGTAAGGTGAAAGCTTGCTGACTG
TCCAAGGCACAAGAGAAAATTGAGGAATTGAAATGCAACCTGAGTATCAAACTAAATATT
CTAATCAAAGGTAGGTACTGTTAGGTGGAATTCTATCAGCAGGCAACTGCAAATGAGAAG
AAGATAGAAGGACGCCCGTCGGGACTTTGGAGGGCATTGTTATTTTCCCAAAGAAAGACG
GCCAAGGGCAGAGGCATGGATTCTTTGCAGAGCACTTCCTTTTGGTTTTTCAGTACTGTT
TCATAGACAGTGGGCTCACATGTTCCTGATAGTGCTGCAGTTGCTTAGAAAGCATCCCAG
TTAATTGCAGTAATTAGAACTTCTGGAATATGCTAGGGCAGAAGTATGTCAAGTATGTCA
CATGAAGAAAATGTGAAATTCAAGAGTAATCCACACGTGAGAAACTAGACAATGTACATT
CATGTGTTCTCTTGAAAGGAAAGGGAGAGCTGTAAGCTTCACTCTGTCCTACACCGGAGA
AAAGCAGGAATAACTTTACCGTGGAAATAATGTTTAGCTTTTATCAGAGAAAATTGTCCT
TCTAGAGCATAGAGTCCCAAAACTCAATTCTGGTTTTCCCCTGTTTTTTTTTTTTTTTTT
TTTCCCAACATATGAACTGCAGCATATCACTTTTTCTTTTTGTGCCTCAGGTTCCTCACC
TGTAAAATTGAAAAATATATGTATTAATAATATTATTAATAATAATAATGGTAATGTAGT
ACTTGTTTGTAAAGCACTTTGAGATCCTTGGTTGAAAGGCACCATAGGAGTGCCAAGTAT
TATTATGTGGCCAAGGGGGTTATTTAAACTGTCAGTTCCCAAAGGCCAGGAAAGGTTGGG
GTCATTTTTCTTAAAGACGAGCTGTAAATATCAACTAGGCAGCCAATAGTGTTGACTATG
AAGATGCAAAACTATTACTAGGCTGATAAAATCATAGTTTCTTAATGGCTACCAATAAGG
CAAATATCACAATAATAAACGCCAAATTCCTTAGGGCGGACTATTTGACAACCACATGGA
AAACTTTGGGGGAGGCATGAGGGGGGAACATCTCAAAATGCCAATGTAAAATTTAACTTA
CAGCAATATTCACCAGCAGAAAATGTCTTTCATATGGAATGATTTCATGTTGCTAAGAAA
AAGAATTCAATTTGTAGTCCTGATTTGAATACTAGAATGTTGGCTATAATAGTTCTGTTC
TTACAACACATGAAATTTTTTCGTTTTATTTTATTTTGTTTTCATAGTGCATGTTCATTT
CTACTCACAAACATGTTCTTGGTGTATTTCTTATGCAAACAATCTTCAGGCAGCAAAGAT
GTCTGTTACATCTAAACTTGAATAATAAAGTTTTACCACCAGTTACACA
taacggcgttggtatggtttatatggattcactttcatccttctagcaataggaaataca
gatcattgtaatatatatatatatatatatatatatatatatatatatatatatatatat
atatacaggctctgctgaattgaaatggtgaaatcaaatcaccattctaaaaaattatta