Gene TRIM35 Variant 2
DNA : 26.43 KbNT_023666
mRNA : 4339 bp NM_171982
CDS : 621 bp NP_741983
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  517 bp
aggaggcgggaactgcgggcagaaggcccaccccgctctcccaagatttcccgcgcacac
cggaagtgggtggggctcctccgagcgccccctccctccccctcgccatcccccccgcac
gattggccagcgccgctgtctctcagcgttccaggggaagggactgggcgattcccagca
CTCGGGTCGCGGGCGTTGGCAGCCGGGCGGGTGGGAGGGGCCGGAGCAAAAGTTCCGGGC
GCCCGAGCCGGCTGCTCGTGCCATGGAGCGGAGTCCCGACGTGTCCCCCGGGCCTTCCCG
CTCCTTCAAGGAGGAGTTGCTCTGCGCCGTCTGCTACGACCCCTTCCGCGACGCAGTCAC
TCTGCGCTGCGGCCACAACTTCTGCCGCGGGTGCGTGAGCCGCTGCTGGGAGGTGCAGGT
GTCGCCCACCTGCCCAGTGTGCAAAGACCGCGCGTCACCCGCCGACCTGCGCACCAACCA
CACCCTCAACAACCTGGTGGAGAAGCTGCTGCGCGAGGAGGCCGAGGGCGCGCGCTGGAC
CAGCTACCGCTTCTCGCGTGTCTGCCGCCTGCACCGCGGACAGCTCAGCCTCTTCTGCCT
CGAGGACAAGGAGCTGCTGTGCTGCTCCTGCCAGGCCGACCCCCGACACCAGGGGCACCG
CGTGCAGCCGGTGAAGGACACTGCCCACGACTTTCGG
gtaagagcagcgatttgcacgaggcggccgagccgggtctggaacccggaatcccttggc
tctgcggctcccgcccctcctgcctgccagagcccagtgtgcccgcgtctcgctcccagc
atgcaggaccccacctctccgacccaggttctcagggctggctgcttcttcaaggtcggc
EXON 2  112 bp
ggaaatggaggtgcagagaagtgaaggaacatgttcaagatcacctgctactaggtagag
gtgctgggatttgaacctggtcggccaggtgccagaactcttggctgctacatcaatctg
cctgaaaacaaatcgtgaaatttgggagactgtagagacttctctgctttcatttttaag
GTGAGGAGCCTGATAGCCGAAGAGAGAAGGAACTTTTTACCAACTCACCAGTGGATAGTG
ACAAAGACAAGGCTCCAAACCAGCTCTCCTAACCTTCAGTCCAGGAGGCAAG
gtatatagcagaaaaaacacaggcattccatgtactcattgactgggcaggtggttaact
gaacatctactttgtgcagggacttggacatgcaggggacaaaacaaagtctctcacctt
gcagagcaagcattccttctgcagaagtgtaccgagcaccactatgcaaggtagagagga
EXON 3  96 bp
gatcaggaccttacttaccatttgtgcccagagcacttggcatggatggggttaggcaaa
tgcagttgagttacacttgtgttgaagtggagtcccagttgtaaatgtgatgtgtctgcc
ctctctgcccagcctccagccctaacctgtcttcctccctctctctcattcccatgtcag
GCCAAGTGCAGGAACATGGAGCATGCACTGCGGGAGAAGGCCAAGGCCTTCTGGGCCATG
CGGCGCTCCTATGAGGCCATCGCCAAGCACAATCAG
gtgagcgaacgatggggccaagtgggaagattgggtccactcagggcagtctggggagga
gtgaagatgtgtcagccgtggctttggctcacataacccgctgggtagaggtcggctgcc
ttacctctgatggtcctgtgcagccacgtcctggatgctgactgtggcttctctgccttg
EXON 4  231 bp
catttgaaatcggaacttagaaatttgtgcttataaactattatgttgatattttatctg
taggggttctatacatgatttatttgaacataaatttcctttgctaaaaatgggaaagtt
gctgggctatggatgtcctctccacatctgacccctgactcctcctgctgtcttccgtag
GTGGAGGCTGCATGGCTGGAAGGCCGGATCCGGCAGGAGTTTGATAAGCTTCGCGAGTTC
TTGAGAGTGGAGGAGCAGGCCATTCTGGATGCCATGGCCGAGGAGACAAGGCAGAAGCAA
CTTCTGGCCGACGAGAAGATGAAGCAGCTCACAGAGGAGACGGAGGTGCTGGCACATGAG
ATCGAGCGGCTGCAGATGGAGATGAAGGAGGACGACGTTTCTTTTCTCATG
gtaaggagctcagcgtctggattcagtgacagggccacatgttccaggaccagctgggag
ccatagcccaccagccctggccaacgtcatcttcctggagcttcctgggtactggcctgg
aggagctcacaagtaacctgctctgcttgtgtcatgaaactaaaaagacttatcagggcg
EXON 5  23 bp
tgttcaacacatgaacttttggataatatgttcaaatcatagcagggatgttattgttaa
catcttgacaatattaagacttatgatccatggaatgcatgacttcttttgaggtcagaa
acatatacatttcctctacatctgtgtctctgtgttatttttttatttttattttttcag
AAACACAAGAGCCGAAAACGCCG
gtaagttgccaaagctggtggaggggaggggaagagtgggcagaaataccaggggtgcaa
actccagtggccccggggcaagcaggtaacaaccagctgggtgcaccagcacacatgagc
tactggccctggttttagagggagaggtggacaatggccaggtggagagagccctctcac
EXON 6  119 bp
ccctgttggccttggcccatctcccatcgtagcccagtccagtcttgtcttggagaaggt
ggccaggaaacttgggcctgagggaagggaacaagtcctgttgctggtttccagttggcc
cagttcggcccaggttgcatggctctggccctgcccaccatacccattgtacttttccag
ACTCTTCTGCACCATGGAGCCAGAGCCAGTCCAGCCCGGCATGCTTATCGATGTCTGCAA
GTACCTGGGCTCCCTGCAGTACCGCGTCTGGAAGAAGATGCTTGCATCTGTGGAATCTG
gtgagcgggggtgccggcaggtgtcccaagcatgggtggaagcccttcatgttagcaaag
aggcaccagggctggtctctgccgggcccacctcccacctcctcagagctcccctcctct
ctcagctgatccctctgccagtccctcgcaggcaggttcctgtaccctggtcttttccac
EXON 7  3241 bp
tgccgcatatcttctgggggatacagcccaacccctgccaccactccagccctgggccac
tccttgcatggacttggggccaggtgtgacacagtggttggtttgtggggctggagatat
ccacgtgtggcctaagggacctcaggtttgctgattccccatttccgcctctgcttgcag
TACCCTTCAGCTTTGACCCCAACACCGCAGCTGGCTGGCTCTCCGTGTCTGACGACCTCA
CCAGCGTCACCAACCATGGCTACCGCGTGCAGGTGGAGAACCCGGAACGCTTCTCCTCGG
CGCCCTGCCTGCTGGGCTCCCGTGTCTTCTCACAGGGCTCGCACGCCTGGGAGGTGGCCC
TTGGGGGGCTGCAGAGCTGGAGGGTGGGCGTGGTACGTGTGCGCCAGGACTCGGGCGCTG
AGGGCCACTCACACAGCTGCTACCACGACACACGCTCGGGCTTCTGGTATGTCTGCCGCA
CGCAGGGCGTGGAGGGGGACCACTGCGTGACCTCGGACCCAGCCACGTCGCCCCTGGTCC
TGGCCATCCCACGCCGCCTGCGTGTGGAGCTGGAGTGTGAGGAGGGCGAGCTGTCTTTCT
ATGACGCGGAGCGCCACTGCCACCTGTACACCTTCCACGCCCGCTTTGGGGAGGTTCGCC
CCTACTTCTACCTGGGGGGTGCACGGGGCGCCGGGCCTCCAGAGCCTTTGCGCATCTGCC
CCTTGCACATCAGTGTCAAGGAAGAACTGGATGGCTGAGCTGGCCCGGGGCTGCCCCGGT
CTTGTGCCACAGCACTGTTTTCTTTCTGCCCTCTTCCTAATGCCCACACTGCTTGGGCAC
TATTGCGCCCCTGCCTCCTTGCCAGGCTCTTCCTCCTGTCCTGCCTGGTCCTTTTCCATG
ACTCCAGGCTGTGCCTCTCTCCATGTTTGGTCCCTTCTGTGCCCATGGTCAGGAGCTATT
CGGGTGGCACCTCGCTGGCCAGGCTCTCCCGAGTCGTGGCACCTCCACAATGTGAATTTT
CTGAATCCCTATTCCAGGATTTCTGGGAATAATGTTTACTTCTAGAATGGGCCTGTTGTA
AACCATCTCATCGAGGTGTGGTAAAGCCATTGGATGAGGAGGGGACTGCCATGGAAAGGA
GAGTTTGTTACTTACGGTTCTGAGAGGAGGGGCCACATAGGAAAGCCCCACGGTGGGTCA
GAAGGCGGAAGGAGGGAGGGGAACGTGTGGGCAAGAGACTTCCTCTGGTTTCCTCAGGAG
GAAATGGGCAAGGCAGAGTAAGCAGGGGAGACAGGTTTAAGGGTAGCTGGCTTGAGTAAT
TTCAGTGGCTCTCAGGATAGGGGCTGCCCTTTTTGTCTGATACCTGGCCCCGGGATAGTC
AGGACAGGTGAATGTTGGCCTGGGGTGTGACAGCCCTGGGAGAGCCATGTGAAGGAGGCA
GCTGGCGCCATCGCTCCGGATTAGTTGGTTTCCATAGGAAAGGCATGCTTTCAGCCAGAT
GCTTGCCATCTCTAGGGATTGGGGGATTGGCTAGCCTGGGAGGATCAGTCTGTCCAGGTC
AGCGAGGCCCCAGATACCAGAGCATCAAGAGTACAGGAAATACAGTTAATGCAGGGCCTC
TGTGTGGCTGGATCCTCCGTCTCCATCAGATCAGCTCTGATTGATCTATTCTTGCACGAT
TTCCTCTGAACACAGGGTTCCAGAGTACTTAAACACAACATTTTTTAAATCGTGATTTCG
GCCTATTTCCTTGCCAGGCCTGTTTCCCCACCAGGAAATGAGATAGGAGGACTGGATGAG
GATGTCCTGTTATAGTTGCTGTGGAGGAAGTTCCTCTGGTTAATTCTCATCAGCGTCTGC
AGAAAAGAAGGAAAGAGGGCACCCTTTTCAGTTGGGAAGAAAGGAGAGGGGTGGCGCCAT
GGACGTGGCCCTAAACGCTGTGGGAGAGGGAAGAGGAGGCTGGGCCTCGCTGCCCTCTTG
TCTCTGCTGACTTCAGCCTGGTCATGCTTGCTCTGCCACTTGCGATTTCATCCCTAATTT
CTTCCTCCACCATGCCTGCAGACTTTTCCCTGGGCTTGTTTTTTCTCGCACATCTCTGAA
GAGTTTTTAATCTTCAGCTCATCATGTCCCAGGAAGTGGCATCATAAAAGGAAATATTTT
TTTTTCCTAGGAGCAGTGTTAAAATCTGGGTCACATTCCTGACCAAGGACAGCATCCTGC
CTTCTGCCCATCCCCTTCAGTTCACAAAAGCTGACATTTTAAACAAATCATGACTCACAC
GTATTAATTGGTTATAAATATGTTGTGTACACTGGTTAGATAAAACTTAAGGCCACAAGG
AGGGCCCAGGTAGGCGATGTCAGTGTGTGAAGGGGCTGGATTGGGCGTGGTGAGGATGTT
GGCAAACCAGTGCATGCACCTGGTTGGAAGATGCTCAGCCTCACAAAAGCTCCAAGCCCT
TTGGGAGCCAAAGTGTCTGAGAGTGTGACCCTCTCCTGTAAAGTATTTATCCCACCCATT
AATATAATTTCTGTATAATAAACTTGACCTGAAATTATTTCATTCTTTATATTAAACTTT
TAAAAATGTTTTTTATTTTCACCTTAGATATGGGAAGAGTTTTTTTTTTTTTTTTTTTTT
TAACAGGATAACTTGAGCAGGCTAGGCCTCTTAAAAAAAAATTTGAGCTAAAACTCATTT
TTCTTTTGGCATTTTCTTTTCAATGTTCTTATAAGCAAAGTTCATCCATGTTGTAGCATG
TGTTCAACTTTATTTTTTCATCGGGTAATATTCCATTGTATGGAATGGTAGTACTACATT
TTATTTATCATGCATCGATTGGTGGACATTTGGATCGTTTCTACTTCTTGACTATTATAC
ATAATGCTGCTAGGAACTTTTGTGTATGAGTTTTTGTGTGGACATATGTTTTCATTTCTC
TTTGGTATATGCCTGGGAGCAGATTTGCTGGATCATATGAAACTCTATTTAACCCTTGAG
GGACTCCCAAACTGTTTTCCAATGTGGTGACACAATTTTATATCCCATCAACAGGGCATG
AGGGTTCTGATGACTCCACATCCCTCAGTGCTTTTTATTATCTATCTTTTAACTTAGCCA
TCCTAGTAGGGGTAATGTGGCATCTCATTGTGATTTTGGTTTGCATTTCCCTGATGGCGA
ATGATATTGAGCATCTTTTCATGAGCTTATTGGCCATTTGCATATCTTCTTAGGACAGCT
ATCTTTAGATCACTTGCTCATTTTTTAATTGGGTTATTTGTCTTTTTATTATTGAGTTGT
AAGAGTCCTTTTATAGCCTGGCACAAGTCCCTTTAACTGGTATATGATTATAAAATTTTT
CTCCGTGAGCTGTTTCATTTCCTTGATGATGTCCTTTGAAATACTAAAGCTTTTAATTTT
G
atgatgtccaatttttatttattttttcttttgttgtacatgtatcctagaaatctcact
tttgatactgcccttaggtccatgtaagttcggggttttggctcagggatggggcagtta
ttctgttggcaggaagcgctagtccacgagttcattaattcttccctgaagcccctctcc