Gene TOP1MT Variant 1
DNA : 25.52 KbNT_023684
mRNA : 1910 bp NM_052963
CDS : 1806 bp NP_443195
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  141 bp
agggaaaccagggggaggccggcaggacagtcagtggtcctgctgccgcagccccgtgca
ggcttagaccgcccagccttgggatgagcgccgctgggggcggaggccgcgctcgggggc
ggggctggccgctgggggcggggcggggctggccgctggggcggggcccagcttgtcgct
CTTTCCCGGAGGCTGGCAGATGCGCGTGGTGCGGCTGCTGCGGCTCCGGGCGGCTCTGAC
GCTGCTCGGGGAGGTCCCCCGCCGCCCGGCCTCCCGGGGTGTCCCGGGCTCGCGCAGGAC
GCAGAAGGGCAGTGGAGCCAG
gtaaggtgtcccagtgagcaggcggcgagggccctgagcaccgggcttgggtaggtccag
aaaggggagtggcaggcctcgtgggacggccttgccctgcttccggttttcccaaaagtc
gggccaggagagcatgcgtgccgcggtgtgaccggcccgcctcctgcccggggtgtacag
EXON 2  116 bp
catggggtctgaggtcaggtagggttgcctccctctgcaggccttgttttcctcccccgt
gaggtggaggccacactgctcacctgctaggagccacagggaggagccactgtgggagcg
gggaagaggctcatgcagggcctggcccaggagagtgacacgtcctgtctccgtctttag
GTGGGAGAAGGAGAAGCACGAAGACGGGGTGAAGTGGAGACAGCTGGAGCACAAGGGCCC
GTACTTCGCACCCCCATACGAGCCCCTTCCCGACGGAGTGCGTTTCTTCTATGAAG
gtaaggatgcagggagcggctcctccccagcctgcgcttggttccctgggcgtgggctcc
cagtgggcatctggctcgctccctcagcccccctgcaggcttctggctatgagcgctctg
tgccctcttcttgcaggtgatgcgtgggggctgctgaccaactgacccatgctcagaggg
EXON 3  122 bp
ccacgcaggttgattgtcgtgtgtcatgcagaacatgcttctgaacttacagaagaaggc
ctagcttcttgctcttggcatagtacgcacgaaagcgtagtttaaagcaatgaggtcatg
tcagctggaggccgagcctctggccgctctctcatacgatgtgtcttccgatgcctgcag
GAAGGCCTGTGAGATTGAGCGTGGCAGCGGAGGAGGTCGCCACTTTTTATGGGAGGATGT
TAGATCATGAATACACAACAAAGGAGGTTTTCCGGAAGAACTTCTTCAATGACTGGCGAA
AG
gtaggtaccctgggcggccgccacagctgtcctggacctggctggctaggcgtctgcggt
tctgcagtgctgcctctgaacgcccctcgcaagttctcggtggcccctgtgtgaccactc
acaggtgccgtcatggctctttgcagcttcgagctcctgggctcaagccatcctcctgtc
EXON 4  123 bp
ggggtctgcggggagaggctctatttacggggccgcaggaccgtgcgcaggttctgccta
ttgcacacacgcctccgtcggacatggcgagagcgcgtttctgtccgtcagacatggcga
gagcgctctgcatgtctgtccttcagacatggtgagagcgcgtgtctgtggtttttgcag
GAAATGGCGGTGGAAGAGAGGGAAGTCATCAAGAGCCTGGACAAGTGTGACTTCACGGAG
ATCCACAGATACTTTGTGGACAAGGCCGCAGCCCGGAAAGTCCTGAGCAGGGAGGAGAAG
CAG
gttgggctgcctcgagcgttgtgtgacctgaagtggcccctgggaacgagaggccggcct
ggcccaaagactgagaaaggcctgtggccttagagaagccccttctcacaaagctgctct
tttctcgtcagccttagcgcccctgcatgtgcttaagtgtcgttccgcttccccagagca
EXON 5  188 bp
ccccctgcaagcccacctgcactgtcccctgcccctgcaacctccatggattgtgaaggg
ctttgagggtccagctgagttagccagacagagcagggtggtcccgggttagcaacaacg
gactgaggcctgttctcttctcttcactgctaatgtccactgactgttttattaactcag
AAGCTAAAAGAAGAGGCAGAAAAACTTCAGCAAGAGTTCGGCTACTGTATTTTAGATGGT
CACCAAGAAAAAATAGGCAACTTCAAGATTGAGCCGCCTGGCTTGTTCCGTGGCCGTGGC
GACCATCCCAAGATGGGGATGCTGAAGAGAAGGATCACGCCAGAGGATGTGGTTATCAAC
TGCAGCAG
gtgcgtggccgggcgggcagcaggcgggcactggacccccgccacccgggtgaggctggc
ttttcttcacctcctgggagagggaggcacaccgagaaacatgtggttggtgacccccac
accattcctgtggagctcagcctgtaggcgtggccgggcaagggcggccttcccagggtg
EXON 6  145 bp
tagattgagtggctgcttttgtctgagctgccaggcaggccacctctgatgccagactcg
gtcaggagccatgccaccaccatagccaccacgtgggacggttgaccagagcagctcctt
ttgcttgcattccagagaataaggtctccaagttatgtttgggtcgttgttctgctgcag
GGACTCGAAGATCCCCGAGCCGCCGGCGGGGCACCAGTGGAAGGAGGTGCGCTCCGATAA
CACCGTCACGTGGCTGGCAGCTTGGACCGAGAGCGTTCAGAACTCCATCAAGTACATCAT
GCTGAACCCTTGCTCGAAGCTGAAG
gtgagcgcagggcttggcagggtgtttcctccccaggaggtccccctgaggacgccggca
gggaggtgtgtaagccgggcaccggcagaggcttctgagatgggctgggagtcggccagc
ccgtgctgaggtcatgctgtgccagcaggcacaagccccaaagccaggagtgggcatggg
EXON 7  144 bp
gccaggagtgggcatgggtgctcactgccggcatcacccagctagatttgctgccccagc
ccctgaccacggcaccactgagtggagaagcacgaggtttgggggagggagagttgacag
cctcctccgttatttaacaggaatgtgaatgttttctttcctgttattttcttcgtttag
GGGGAGACAGCTTGGCAGAAGTTTGAAACAGCTCGACGCCTGCGGGGATTTGTGGACGAG
ATCCGCTCCCAGTACCGGGCTGACTGGAAGTCTCGGGAAATGAAGACGAGACAGCGGGCG
GTGGCCCTGTATTTCATCGATAAG
gtatgcggccttctcgcttcctggcggctcttcatcctggttctcctggcgaggactccc
agttggatggtgcagtgtggcgacgtgggcctgtgtgtggggtggaacctcattctgatg
gggggggtgtgtgcatgtgcacacgtgtgtgggtgtgaacatgtgtgtagggtgtgcatg
EXON 8  186 bp
gtgtgtgtggcgtgcgtgtgtggcgtgcgtgtgtgtggcgtgcgtgtgtggagtgcgtgt
gtgtggcgtgcgtgtgtggcgtgcgtgtggcgtgcgtgtgtggcgtgcgtgtgtgtggcg
tgcgtgtgtgtggcgtgcgtgtgcacgcaccacccactttgaccattccccaccaactag
CTGGCACTGAGAGCAGGAAATGAGAAGGAGGACGGTGAGGCGGCCGACACCGTGGGCTGC
TGTTCCCTCCGCGTGGAGCACGTCCAGCTGCACCCGGAGGCCGATGGCTGCCAACACGTG
GTGGAATTTGACTTCCTGGGGAAGGACTGCATCCGCTACTACAACAGAGTGCCGGTGGAG
AAGCCG
gtgagtgccctcgcgccagctgcccccgctatgtgacacgtatttgctctggatgtctgg
gggcgtgccggagctgccgtggggtctgtggcccgtttgccacgtcctgcctgctgggtg
aggcctgctgtgccggggctgatcggggtaaaggtgaaggagaggctgtgcaccatggta
EXON 9  69 bp
gccacactggagggtgggggccgtgtcacgggaggatgccgacaggtgacggtgatgctg
ctcgggccaccttcctcagggaagcctcccgtgggctcccaggctctgcgtagacgccct
tcaggtcctcactggattcgggttttttctgtcctctgaaattccttctttctccttcag
GTGTACAAGAACTTACAGCTCTTTATGGAGAACAAGGACCCCCGGGACGACCTCTTCGAC
AGGCTGACC
gtaagccggctcgtgtttcctcagcagtgggcggcggcaggacccagtgagagggcgtgg
gcgctgagtctggcccagggttttgtcctgacccaacggctgacatgtcctttccttccc
gcgggaggctgggacggccccgcaaaaccacgtaattatagagaccattttcctccccag
EXON 10  115 bp
gtaagccggctcgtgtttcctcagcagtgggcggcggcaggacccagtgagagggcgtgg
gcgctgagtctggcccagggttttgtcctgacccaacggctgacatgtcctttccttccc
gcgggaggctgggacggccccgcaaaaccacgtaattatagagaccattttcctccccag
ACGACCAGCCTGAACAAGCACCTCCAGGAGCTGATGGACGGGCTGACGGCCAAGGTGTTC
CGGACCTACAACGCCTCCATCACTCTGCAGGAGCAGCTGCGGGCCCTGACGCGCG
gtgagcctgccccacacccacactcagcgcggggggagcacggcccctgccccagaccgg
gctccccggctggcccttgttgagtgagcctcggggtggggccgcttctttgggaaatgg
gctgaggttgtgggctggctgcttggcagcctaggtggccagagtcctggggaggaggag
EXON 11  128 bp
gccctgctctcgaggccaccttggagggtcactgacccttggccctcactctccccatcc
cagtgggtgcctgtgtgagtggaaggggctgcgctgtgtggcgcgttaaggccggctcag
ggcagacagggagggtggccggccccgtgggtgctgcctctgacagcccgtgcctctcag
CCGAGGACAGCATAGCAGCTAAGATCTTATCCTACAACCGAGCCAACCGAGTCGTGGCCA
TTCTCTGCAACCATCAGCGAGCAACCCCCAGTACGTTCGAGAAGTCGATGCAGAATCTCC
AGACGAAG
gtagcagctcccaggagagcccccagcccagccctcaagggacccctccccctccccaga
gcctcggcacaggcctgggagccagctgcggtgggcacgtagggtgtggaagggtgtggg
cacaggggctggtgcgggatggggaggggcagccctgtctggacccttttcctgcagatc
EXON 12  95 bp
aaggtagcagctcccaggagagcccccagcccagccctcaagggacccctccccctcccc
agagcctcggcacaggcctgggagccagctgcggtgggcacgtagggtgtggaagggtgt
gggcacaggggctggtgcgggatggggaggggcagccctgtctggacccttttcctgcag
ATCCAGGCAAAGAAGGAGCAGGTGGCTGAGGCCAGGGCAGAGCTGAGGAGGGCGAGGGCT
GAGCACAAAGCCCAAGGGGATGGCAAGTCCAGGAG
gtgagtacccgtgccctcagacgccttctcccggggccctgtcccaacccgtagggtcca
gccccacagggtcggtgggagacgacccttgttgtctccttgtgcggagacgagagattg
tagaaataaagacacaagacaaagagataaaagaaaggacagctgggcccgggggaccac
EXON 13  150 bp
ggggtggggctgagcttccacctttgatcccggctggtcttttgctgtgatggatgactg
atgacaatgacagggacagggctgcactgggagggaaggcggcagggccagagaagtgca
ggtctcctcaggtggcgctagtccagcgcggggcctcgcggcctcctcttctcttgccag
TGTCCTGGAGAAGAAGAGGCGGCTCCTGGAGAAGCTGCAGGAGCAGCTGGCGCAGCTGAG
TGTGCAGGCCACGGACAAGGAGGAGAACAAGCAGGTGGCCCTGGGCACGTCCAAGCTCAA
CTACCTGGACCCCAGGATCAGCATTGCCTG
gtgcgtgtgcctggggtctcagttcccacctgtggcctatggggggcctgggttttccag
gaggcctctgttcagtcccagcattgcccttgtcccgtgtcccctggggtcagcacaggc
cctccctgtgacagggacccatgatgctgagtcctgtgtcatcagctctccctgccctga
EXON 14  188 bp
gatgctccagggtggcggcatgcgtggggtggggttggcctagaggagcaggtcccagct
acaccaggcggctctggtgtctctgctgcatggaggacgctcgcccttgccgagcaccct
gacctggccttcaaggtgggtgagttgcctgcttgcctgggctgatgctgcctcccgcag
GTGCAAGCGGTTCAGGGTGCCAGTGGAGAAGATCTACAGCAAAACACAGCGGGAGAGGTT
CGCCTGGGCTCTCGCCATGGCAGGAGAAGACTTTGAATTCTAACGACGAGCCGTGTTGAA
ACTTCTTTTGTATGTGTGTGTGTTTTTTTCACTATTAAAGCAGTACTGGGGAATTTTGTA
CAATAAAA
tgtgtgcaagtgcttgtacatcactagaaaaagtccccaggccggccgggcacggtggct
cacacctgtaatcccagcactttgggaggctgaggcgggcggatcacaaggtcaggagat
cgagaccatcctggctaacacggtgaaaccccatctctactaaaaatacaaaaaacttag