Gene TNFRSF10D Variant 1
DNA : 26.63 KbNT_023666
mRNA : 1726 bp NM_003840
CDS : 1161 bp NP_003831
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  232 bp
gaaagagccagttcctgtccgtccatgcacccacccacacaacctgggccctcctggagg
tgctgggggagacccagcctgagtgcctggaagtgactgcgggaagggagtacaactgac
cacgccttttttccggggtataaaagcggaggagcacgttctattctggcagtgtagctg
CGAGAACCTTTGCACGCGCACAAACTACGGGGACGATTTCTGATTGATTTTTGGCGCTTT
CGATCCACCCTCCTCCCTTCTCATGGGACTTTGGGGACAAAGCGTCCCGACCGCCTCGAG
CGCTCGAGCAGGGCGCTATCCAGGAGCCAGGACAGCGTCGGGAACCAGACCATGGCTCCT
GGACCCCAAGATCCTTAAGTTCGTCGTCTTCATCGTCGCGGTTCTGCTGCCG
gtgagtctccgccgcggtccctggctggggaagagcgcacctggcgccgggagtgggcag
ggagagagggggacacggtggggatgcttggcccgggtcgcctgcggccgggcatgtctg
ggcaggacgaacccgccgtcggagtcaggggaagagtggggtgcccgggctgggcaggag
EXON 2  106 bp
aaaatagctacctaacaggccaggggacaaacacggatgcaaaagaatgaaagtttggaa
tgggaaaaaagtccaggctctcatgggttttgtcacttggggtgaagggaatgtgagacg
gagcctgggagaggtaaggtctggaagccactcaagcccatctctgccttgtccccacag
GTCCGGGTTGACTCTGCCACCATCCCCCGGCAGGACGAAGTTCCCCAGCAGACAGTGGCC
CCACAGCAACAGAGGCGCAGCCTCAAGGAGGAGGAGTGTCCAGCAG
gtgcactcttatttttaaaaatcagtttatttttagttgacagataaacattgtatatat
tcatggtgtacaccatgatgtttggaaatatgcacgcattgtgaaatggctaaatcaagc
taattcacatacttatcgtgtatttgttgtaagaacacttaaaagtctactcagcaattt
EXON 3  114 bp
agtgccagtcaaaggtatgtaatagtgtaatagatgcagaattgatgacaagaccaagcc
aagaagagcagatttctctgtctggattccactgagggccaaaagagaaatttgccagcc
attgtcagcctctgggaattctgtggtgactcattcattaacttttctctcccttcccag
GATCTCATAGATCAGAATATACTGGAGCCTGTAACCCGTGCACAGAGGGTGTGGATTACA
CCATTGCTTCCAACAATTTGCCTTCTTGCCTGCTATGTACAGTTTGTAAATCAG
gtacagaatgtgtggaccccttgcccagaggtggagtgcatagtgatgaggtgggagctg
tagccgatgtgagtcggggaaccaagttctagcccaacttggtagtcttcatcatgccct
gttccatgattatgactagttgattaaaaaaaaaaaatagaaatcttttttttcttttct
EXON 4  112 bp
ttggtccttacatacagggtgggtgtcctgtatgagtcccgagtgtgctggtgcagaaac
cagccctcagaactccttggtgaactgagttgagctgagtgggaggggatggggtggtga
ggaagggtggacagacatgtcagggaaacacattctcaaaaccttatgctctgttgtcag
GTCAAACAAATAAAAGTTCCTGTACCACGACCAGAGACACCGTGTGTCAGTGTGAAAAAG
GAAGCTTCCAGGATAAAAACTCCCCTGAGATGTGCCGGACGTGTAGAACAGG
gtaagacagcagccaggggctcccaacagctttcaggaacctgaaaagacctgattcacc
tggtacctctatctctccgctgaccccatggatcctccaggcccgaggcctccctgagcc
tgtggggtttcctgagcctgcgttggcccctcctggtccatctgcctgtccccaccccta
EXON 5  254 bp
gcatgctcagacccttccccagcctcaagaagggagcacagggggacccactgctgacac
gaggagcctgtcctcctgacgccttctcagggactttgggcagggagggtggctcctctt
tcatcccacctggccagctttccatcaagagtccctgtctccctctctgtgtgtacccag
GTGTCCCAGAGGGATGGTCAAGGTCAGTAATTGTACGCCCCGGAGTGACATCAAGTGCAA
AAATGAATCAGCTGCCAGTTCCACTGGGAAAACCCCAGCAGCGGAGGAGACAGTGACCAC
CATCCTGGGGATGCTTGCCTCTCCCTATCACTACCTTATCATCATAGTGGTTTTAGTCAT
CATTTTAGCTGTGGTTGTGGTTGGCTTTTCATGTCGGAAGAAATTCATTTCTTACCTCAA
AGGCATCTGCTCAG
gtaggtgctggctgagggtgggagcgctgggcactgtctgccctgccctctcccactccg
ttcccacagacagtaatccccatccctgcccctggtccaagcgtctccagcctggcttgg
tcttccttcttgtgatcgccccatccccacgtcctgtgtatccccaaggaccctggtctc
EXON 6  32 bp
ccccttctcatcccccttcctcagggtgtcccctaattgcaaggccccattctgtcccca
gccccagggctccttgtccagtgtcccagcccccagccagccctgcgccccactgtcctc
tgggagggaggtgctgcatgggcccctccccgcctgctcaggagactgcttcttttccag
GTGGTGGAGGAGGTCCCGAACGTGTGCACAGA
gtgagttggtttctccagaaactgggggcttcgtgggttcaggaactgcttcccatccac
tgccgagcctgggtgggcacaatcccttgtcctcatggctgccctgactctctgacatgg
cctgggggatctgggctgactgtgggggacacacggccattttgagcagcacacagacca
EXON 7  186 bp
ccccatggggatggggtgaccacctgacccacctcagcatggggtcctggatgtgctgag
cctcagctgcctggggtgacctcattggaaggggttggggatggcaggtccagctgtgta
ctggggaccctgaagctgagcccggggtgtggacttgagtgggctctttgtcttcccaag
GTCCTTTTCCGGCGGCGTTCATGTCCTTCACGAGTTCCTGGGGCGGAGGACAATGCCCGC
AACGAGACCCTGAGTAACAGATACTTGCAGCCCACCCAGGTCTCTGAGCAGGAAATCCAA
GGTCAGGAGCTGGCAGAGCTAACAGGTGTGACTGTAGAGTTGCCAGAGGAGCCACAGCGT
CTGCTG
gtgagttgaggagggactgtgccctgcctggcgtgcagcctgcacaggactttgtagaca
gtgggacatggcagtgcctcctctttcctggcccaaggggacatggagcctttgggagac
aggggactgcaggggacggagcagctgcactgaggtggtgaccgtgccagtctgcaggac
EXON 8  73 bp
tctcaatgagccaccagcacacagagcccaagagctatggaggaccagaggtttgtctcc
atctccatggagacccaagagggaaagcgctgcaggtctcttgctggctagtggtcaggg
tcagtactagactgcaggactcctgactctgaccagagcattccccactgtgtgttacag
GAACAGGCAGAAGCTGAAGGGTGTCAGAGGAGGAGGCTGCTGGTTCCAGTGAATGACGCT
GACTCCGCTGACA
gtaagtgttttgtgccttgagacgcagcaggaggacagggaatagggacggtgtcctaac
tgctgtccctatagctgagagggctcttctggaggtttcactgctggaagcagggggccc
catgtcgatcctgtgctgatcgtccttggagcattgagaccctaaatctcttctctcttc
EXON 9  617 bp
gtgttttgtgccttgagacgcagcaggaggacagggaatagggacggtgtcctaactgct
gtccctatagctgagagggctcttctggaggtttcactgctggaagcagggggccccatg
tcgatcctgtgctgatcgtccttggagcattgagaccctaaatctcttctctcttctcag
TCAGCACCTTGCTGGATGCCTCGGCAACACTGGAAGAAGGACATGCAAAGGAAACAATTC
AGGACCAACTGGTGGGCTCCGAAAAGCTCTTTTATGAAGAAGATGAGGCAGGCTCTGCTA
CGTCCTGCCTGTGAAAGAATCTCTTCAGGAAACCAGAGCTTCCCTCATTTACCTTTTCTC
CTACAAAGGGAAGCAGCCTGGAAGAAACAGTCCAGTACTTGACCCATGCCCCAACAAACT
CTACTATCCAATATGGGGCAGCTTACCAATGGTCCTAGAACTTTGTTAACGCACTTGGAG
TAATTTTTATGAAATACTGCGTGTGATAAGCAAACGGGAGAAATTTATATCAGATTCTTG
GCTGCATAGTTATACGATTGTGTATTAAGGGTCGTTTTAGGCCACATGCGGTGGCTCATG
CCTGTAATCCCAGCACTTTGATAGGCTGAGGCAGGTGGATTGCTTGAGCTCGGGAGTTTG
AGACCAGCCTCATCAACACAGTGAAACTCCATCTCAATTTAAAAAGAAAAAAAGTGGTTT
TAGGATGTCATTCTTTGCAGTTCTTCATCATGAGACAAGTCTTTTTTTCTGCTTCTTATA
TTGCAAGCTCCATCTCT
actggtgtgtgcatttaatgacatctaactacagatgccgcacagccacaatgctttgcc
ttatagttttttaactttagaacgggattatcttgttattacctgtattttcagtttcgg
atatttttgacttaatgatgagattatcaagacgtagccctatgctaagtcatgagcata