Gene TNFRSF10B Variant 1
DNA : 49.04 KbNT_023666
mRNA : 4054 bp NM_147187
CDS : 1236 bp NP_671716
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  429 bp
acagccaagcgcgcgaccccgggaggcgtcaactccccaagtgcctccctcaactcattt
cccccaagtttcggtgcctgtcctggcgcggacaggacccagaaacaaaccacagcccgg
ggcgcagccgccagggcgaaggttagttccggtcccttcccctcccctccccacttggac
GCGCTTGCGGAGGATTGCGTTGACGAGACTCTTATTTATTGTCACCAACCTGTGGTGGAA
TTTGCAGTTGCACATTGGATCTGATTCGCCCCGCCCCGAATGACGCCTGCCCGGAGGCAG
TGAAAGTACAGCCGCGCCGCCCCAAGTCAGCCTGGACACATAAATCAGCACGCGGCCGGA
GAACCCCGCAATCTCTGCGCCCACAAAATACACCGACGATGCCCGATCTACTTTAAGGGC
TGAAACCCACGGGCCTGAGAGACTATAAGAGCGTTCCCTACCGCCATGGAACAACGGGGA
CAGAACGCCCCGGCCGCTTCGGGGGCCCGGAAAAGGCACGGCCCAGGACCCAGGGAGGCG
CGGGGAGCCAGGCCTGGGCCCCGGGTCCCCAAGACCCTTGTGCTCGTTGTCGCCGCGGTC
CTGCTGTTG
gtgagtccccgccgcggtccctggctggggaagagcgtgcctggcgcctggagagggcag
ggagagagggggacacggcgggggtgcgtggcccgggtcgcctgcggccgggcatgtccg
ggcaagacgcaccagtcgtcggagtcgggggaagagatgggtccccgggttgggcaggag
EXON 2  106 bp
tggccttccctgaaatatgaagggacaaacaaacactaaaggatgtttgagaggtgagag
ctgcaagaaagatgagggttctgtttagcttgggtgcctgggctcaagagaatgtgagtg
gatcctgggaggggtgaggtctggaagccactcatgcccatccctgctttgtccccacag
GTCTCAGCTGAGTCTGCTCTGATCACCCAACAAGACCTAGCTCCCCAGCAGAGAGCGGCC
CCACAACAAAAGAGGTCCAGCCCCTCAGAGGGATTGTGTCCACCTG
gtatgttcaagatgggtctctaatccttgcccctcctccccttgtctccatgagcttcca
gtctgtttcctttgcacttccttgttctttattccacagagaggcattgggtgcctccag
ttcaaggctctgtccttctggagccttcctgctaggatggtatcaagacacacaaatgaa
EXON 3  114 bp
cttttggcagtgctggtttaaggtgtgtaaatgcagaattgatgaactgaccaagctagg
tagaggagatttccctcttttggttccacacatccctgaaagaggagtcccccagccacc
actgccagcttctgggaatcctgtggcatttcattcaccggcttttctctcccctcccag
GACACCATATCTCAGAAGACGGTAGAGATTGCATCTCCTGCAAATATGGACAGGACTATA
GCACTCACTGGAATGACCTCCTTTTCTGCTTGCGCTGCACCAGGTGTGATTCAG
gtacagaacatatggaccccatgcctaaaggtggaatgcggggtgatgacataaaagttg
tagctaaaatgggatcaggagacctagattctggtccaccttggtcttcatcataccatg
ttccatgattttgtctttgagctttttaataaataaaacaggcccggcacagtggctcat
EXON 4  112 bp
ttagtgacagctgaagggtgggtatcctgaatgagccatgagtgtgctggtgcagaaact
ggccctcagaactccttggcaaactgagttgagctgagtagcagggtcttggggtgggga
ggaagggtcaagggacacatcaggaaaacacattcccaaaaccttatgctctgtcgtcag
GTGAAGTGGAGCTAAGTCCCTGCACCACGACCAGAAACACAGTGTGTCAGTGCGAAGAAG
GCACCTTCCGGGAAGAAGATTCTCCTGAGATGTGCCGGAAGTGCCGCACAGG
gtgagacaggagccgggggctcccagtagctccatggaaccccaaaagacccaagtctcc
ttgtacccctgtctctcccctgacagcacccgcaaggggcatccttgaggctgtggctgc
ccctcctggtccctctgcgtgtcaccacccctgccccctgcagcagcctctttccacccc
EXON 5  74 bp
gctcagacccttccccagcctcaagaagggagcacagggggacccactgctgacacgagg
agactgtccttcccctgacaccttctcagggacactggggagggagggtggctcctcttt
catcccacctggccagctttccatcaagagtcccccctctccctctgtgtgtgtacccag
GTGTCCCAGAGGGATGGTCAAGGTCGGTGATTGTACACCCTGGAGTGACATCGAATGTGT
CCACAAAGAATCAG
gtacaaagcacagtggggaagtcccagctgtggaggagacggtgacctccagcccaggga
ctcctgcctctccctgttctctctcaggcatcatcataggagtcacagttgcagccgtag
tcttgattgtggctgtgtttgtttgcaagtctttactgtggaagaaagtccttccttacc
EXON 6  111 bp
cctctgtgtgtgtacccaggtgtcccagagggatggtcaaggtcggtgattgtacaccct
ggagtgacatcgaatgtgtccacaaagaatcaggtacaaagcacagtggggaagtcccag
ctgtggaggagacggtgacctccagcccagggactcctgcctctccctgttctctctcag
GCATCATCATAGGAGTCACAGTTGCAGCCGTAGTCTTGATTGTGGCTGTGTTTGTTTGCA
AGTCTTTACTGTGGAAGAAAGTCCTTCCTTACCTGAAAGGCATCTGCTCAG
gtaggtgctggctgagggcgggggcacagggcactctctgccctgccccctcccacccta
ttcccacagacagaaacgcctgcccctgccccaagtctaagtgcctccagcctggctcta
tcctcctcctcgtggtcacccccatccccacatcccgtgcaccccccaggaccctggtct
EXON 7  32 bp
cccttctcatcccccttcctcagggtgtctctgagttgtaaggccccattctgtccccag
ccccagggctccttgtccagtgtcccagcccccagcccagccctgcgccccactgtcctc
tgggaggggggtgcttcatgggcccctcccttcctgctaaggagactgcttcttttttag
GTGGTGGTGGGGACCCTGAGCGTGTGGACAGA
gtgagttgatttctccaggagctgggggctcaggggttcaggaactgcttcctgggacag
cagaacctgggtgggtgggtccccattgtcctcatggctgccctgactctctgaagtggc
ctgggtgctctgggctgactgtgggggacacatggccattttgagcaccacataggctgg
EXON 8  156 bp
acagcactgggggcctggccccagcagcgggtcctggatgtgctgagtctgggctgcctg
cggtgacctcactgagagggggtggggatgtcaggtgcagctgcatactgaggaccctgc
agcgagccctaggtgtggactcctgagtcggctttttgccttcccaatgtctttttccag
AGCTCACAACGACCTGGGGCTGAGGACAATGTCCTCAATGAGATCGTGAGTATCTTGCAG
CCCACCCAGGTCCCTGAGCAGGAAATGGAAGTCCAGGAGCCAGCAGAGCCAACAGGTGTC
AACATGTTGTCCCCCGGGGAGTCAGAGCATCTGCTG
gtgagtgggggacagatcattttgtttcctggcatgctgctcacctgggatttcgtagac
agtgggagagggcagtgccttagctctcctggcccaggggaaatggaacctgaaggagcc
aggggactgcaggggatggagcagctgcactgaggtggtgaccgtgccagtctgcaggac
EXON 9  73 bp
gctgtatcggcctccttccgagagtcttgcccctttgtctcctgtcttgttgccagacct
ttcagaacaatgttctggaagtgacgtgctgcaggtctcagagctggctggtggtcgggg
tcagtactggactgtaggactcctggctctgaccaggacattccccactatgtgttacag
GAACCGGCAGAAGCTGAAAGGTCTCAGAGGAGGAGGCTGCTGGTTCCAGCAAATGAAGGT
GATCCCACTGAGA
gtaagtgttttgctcctggagatgcagcaggaatggagggaatagggacagggtcctaac
tgctgtccccagaggtcagagggctcttccagagtattccatgctggaagccgtgggtcc
tgtgctatagaccatctggaccctaaactgtcttctcccatctcttctccccactctacc
EXON 10  2847 bp
gaggccaggcagtgtgggcgcgctctctgtggatgggaagcgggtgggcactggagcggc
aggtttgcccgcacacggggctctccaggttccccgccttgggttctgggcctgatgtgg
aatcctctgccctttctgagtcccaactcacctggctgtctctgtggctttctccaccag
CTCTGAGACAGTGCTTCGATGACTTTGCAGACTTGGTGCCCTTTGACTCCTGGGAGCCGC
TCATGAGGAAGTTGGGCCTCATGGACAATGAGATAAAGGTGGCTAAAGCTGAGGCAGCGG
GCCACAGGGACACCTTGTACACGATGCTGATAAAGTGGGTCAACAAAACCGGGCGAGATG
CCTCTGTCCACACCCTGCTGGATGCCTTGGAGACGCTGGGAGAGAGACTTGCCAAGCAGA
AGATTGAGGACCACTTGTTGAGCTCTGGAAAGTTCATGTATCTAGAAGGTAATGCAGACT
CTGCCATGTCCTAAGTGTGATTCTCTTCAGGAAGTCAGACCTTCCCTGGTTTACCTTTTT
TCTGGAAAAAGCCCAACTGGACTCCAGTCAGTAGGAAAGTGCCACAATTGTCACATGACC
GGTACTGGAAGAAACTCTCCCATCCAACATCACCCAGTGGATGGAACATCCTGTAACTTT
TCACTGCACTTGGCATTATTTTTATAAGCTGAATGTGATAATAAGGACACTATGGAAATG
TCTGGATCATTCCGTTTGTGCGTACTTTGAGATTTGGTTTGGGATGTCATTGTTTTCACA
GCACTTTTTTATCCTAATGTAAATGCTTTATTTATTTATTTGGGCTACATTGTAAGATCC
ATCTACACAGTCGTTGTCCGACTTCACTTGATACTATATGATATGAACCTTTTTTGGGTG
GGGGGTGCGGGGCAGTTCACTCTGTCTCCCAGGCTGGAGTGCAATGGTGCAATCTTGGCT
CACTATAGCCTTGACCTCTCAGGCTCAAGCGATTCTCCCACCTCAGCCATCCAAATAGCT
GGGACCACAGGTGTGCACCACCACGCCCGGCTAATTTTTTGTATTTTGTCTAGATATAGG
GGCTCTCTATGTTGCTCAGGGTGGTCTCGAATTCCTGGACTCAAGCAGTCTGCCCACCTC
AGACTCCCAAAGCGGTGGAATTAGAGGCGTGAGCCCCCATGCTTGGCCTTACCTTTCTAC
TTTTATAATTCTGTATGTTATTATTTTATGAACATGAAGAAACTTTAGTAAATGTACTTG
TTTACATAGTTATGTGAATAGATTAGATAAACATAAAAGGAGGAGACATACAATGGGGGA
AGAAGAAGAAGTCCCCTGTAAGATGTCACTGTCTGGGTTCCAGCCCTCCCTCAGATGTAC
TTTGGCTTCAATGATTGGCAACTTCTACAGGGGCCAGTCTTTTGAACTGGACAACCTTAC
AAGTATATGAGTATTATTTATAGGTAGTTGTTTACATATGAGTCGGGACCAAAGAGAACT
GGATCCACGTGAAGTCCTGTGTGTGGCTGGTCCCTACCTGGGCAGTCTCATTTGCACCCA
TAGCCCCCATCTATGGACAGGCTGGGACAGAGGCAGATGGGTTAGATCACACATAACAAT
AGGGTCTATGTCATATCCCAAGTGAACTTGAGCCCTGTTTGGGCTCAGGAGATAGAAGAC
AAAATCTGTCTCCCACGTCTGCCATGGCATCAAGGGGGAAGAGTAGATGGTGCTTGAGAA
TGGTGTGAAATGGTTGCCATCTCAGGAGTAGATGGCCCGGCTCACTTCTGGTTATCTGTC
ACCCTGAGCCCATGAGCTGCCTTTTAGGGTACAGATTGCCTACTTGAGGACCTTGGCCGC
TCTGTAAGCATCTGACTCATCTCAGAAATGTCAATTCTTAAACACTGTGGCAACAGGACC
TAGAATGGCTGACGCATTAAGGTTTTCTTCTTGTGTCCTGTTCTATTATTGTTTTAAGAC
CTCAGTAACCATTTCAGCCTCTTTCCAGCAAACCCTTCTCCATAGTATTTCAGTCATGGA
AGGATCATTTATGCAGGTAGTCATTCCAGGAGTTTTTGGTCTTTTCTGTCTCAAGGCATT
GTGTGTTTTGTTCCGGGACTGGTTTGGGTGGGACAAAGTTAGAATTGCCTGAAGATCACA
CATTCAGACTGTTGTGTCTGTGGAGTTTTAGGAGTGGGGGGTGACCTTTCTGGTCTTTGC
ACTTCCATCCTCTCCCACTTCCATCTGGCATCCCACGCGTTGTCCCCTGCACTTCTGGAA
GGCACAGGGTGCTGCTGCCTCCTGGTCTTTGCCTTTGCTGGGCCTTCTGTGCAGGACGCT
CAGCCTCAGGGCTCAGAAGGTGCCAGTCCGGTCCCAGGTCCCTTGTCCCTTCCACAGAGG
CCTTCCTAGAAGATGCATCTAGAGTGTCAGCCTTATCAGTGTTTAAGATTTTTCTTTTAT
TTTTAATTTTTTTGAGACAGAATCTCACTCTCTCGCCCAGGCTGGAGTGCAACGGTACGA
TCTTGGCTCAGTGCAACCTCCGCCTCCTGGGTTCAAGCGATTCTCGTGCCTCAGCCTCCG
GAGTAGCTGGGATTGCAGGCACCCGCCACCACGCCTGGCTAATTTTTGTATTTTTAGTAG
AGACGGGGTTTCACCATGTTGGTCAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCCAC
CTTGGCCTCCGAAAGTGCTGGGATTACAGGCGTGAGCCACCAGCCAGGCCAAGCTATTCT
TTTAAAGTAAGCTTCCTGACGACATGAAATAATTGGGGGTTTTGTTGTTTAGTTACATTA
GGCTTTGCTATATCCCCAGGCCAAATAGCATGTGACACAGGACAGCCATAGTATAGTGTG
TCACTCGTGGTTGGTGTCCTTTCATGCTTCTGCCCTGTCAAAGGTCCCTATTTGAAATGT
GTTATAATACAAACAAGGAAGCACATTGTGTACAAAATACTTATGTATTTATGAATCCAT
GACCAAATTAAATATGAAACCTTATAT
aaaaagaggtgtggtttttgtctcccgccccccaacctcccctcctcctgtgaatcagct
ctgagtgacaggaaaccagggctgtgctcctgctgggactccttccttcctccctcccct
ctgttttcaggcttggcctcctgggggtgtttcctgaatccgactccccagagtttaaag