Gene STAR Variant 1
DNA : 7.29 KbNT_008251
mRNA : 1605 bp NM_000349
CDS : 858 bp NP_000340
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  190 bp
gcaccctcccccgccccaagctccccacaaacggccaaagcagcagtgtgaggcaatcgc
tctatccttgaccccttcctttgcacagtgagtgatggcgtttttatctcctgatgatga
tgcacagccttcagcgggggacatttaagacgcagaacaccaggtccaggctgcagctgc
GGGACTCAGAGGCGAAGCTTGAGGGGCTCAGGAAGGACGAAGAACCACCCTTGAGAGAAG
AGGCAGCAGCAGCGGCGGCAGCAGCAGCGGCAGCGACCCCACCACTGCCACATTTGCCAG
GAAACAATGCTGCTAGCGACATTCAAGCTGTGCGCTGGGAGCTCCTACAGACACATGCGC
AACATGAAGG
gtgagcgctgcgggaaggaggcgatgaggggttggccagctctcagcggatgaggctcag
gccacccaattctgatcctagttgtgcctcttactgggtgaacctgggcaagtttcttcc
cttcttgaatctcagttttcccctcggaagaagtgggctggttactaagatatatccctt
EXON 2  114 bp
ctgccatgggagttgagggcctggctctagttcaggtccctgctagaatcctgtgtgctc
ctgagcaagtcacttccctctccaaaccaacttactcatttgagacaagatgagggggtg
ggagtggtccatctctaaggggctttccagctcctagacaagggttattcccttctgcag
GGCTGAGGCAACAGGCTGTGATGGCCATCAGCCAGGAGCTGAACCGGAGGGCCCTGGGGG
GCCCCACCCCTAGCACGTGGATTAACCAGGTTCGGCGGCGGAGCTCTCTACTCG
gtaagtgctgaggcttctgggctcctggtgctgctggcaggaggttccctggagggtgat
gtggtgcatgtggctttggctcccctcctgccattccttcattttgagaggacgtcccca
gcctagagttcctcaaggccagatccctctctggtcacctggggcggctgtgattaactc
EXON 3  128 bp
caaggccagatccctctctggtcacctggggcggctgtgattaactcgaccagcaggctg
gcccctatggctttagtccgggctcttcagagcaatgagcagacccagagctccagggat
gagagctggtggaggctgggagaagaaggaagctctgtctctcctcggctgtgtatccag
GTTCTCGGCTAGAAGAGACTCTCTACAGTGACCAGGAGCTGGCCTATCTCCAGCAGGGGG
AGGAGGCCATGCAGAAGGCCTTGGGCATCCTTAGCAACCAAGAGGGCTGGAAGAAGGAGA
GTCAGCAG
gtaagtgtcggggagaagcctgtggttcctccatgctccactgccatcctcaaggccagc
tggggttactatttttcccagaattcctgtctcatgcagcagtcactgggtagcaagtgg
ttttatcttgagaactctcctttctcgagaatatatcctcagataatgctcttcccccat
EXON 4  159 bp
aattttgtagttttagtagagacggggtttcaccatcttggccaggctggtctcgaactc
ctgaccttgtgatccacccaccttggcctcccaaagtgctgggattataggcgtgaacca
ccatgcccggccaagaatatttttgtctaaccaccttctgggggctcctttctctgacag
GACAATGGGGACAAAGTGATGAGTAAAGTGGTCCCAGATGTGGGCAAGGTGTTCCGGCTG
GAGGTCGTGGTGGACCAGCCCATGGAGAGGCTCTATGAAGAGCTCGTGGAGCGCATGGAA
GCAATGGGGGAGTGGAACCCCAATGTCAAGGAGATCAAG
gtgagcaaagtccaggtgcaggtggcaggggcccaggagagcccagtgtgaatgctgtat
caaagagaggacccctagctgtggggggtgcttagcccaacacaggctgagtcgtgattc
tggttccccatggcctggtaggtcctgcagaagatcggaaaagatacattcattactcac
EXON 5  185 bp
gcaatgggggagtggaaccccaatgtcaaggagatcaaggtgagcaaagtccaggtgcag
gtggcaggggcccaggagagcccagtgtgaatgctgtatcaaagagaggacccctagctg
tggggggtgcttagcccaacacaggctgagtcgtgattctggttccccatggcctggtag
GTCCTGCAGAAGATCGGAAAAGATACATTCATTACTCACGAGCTGGCTGCCGAGGCAGCA
GGAAACCTGGTGGGGCCCCGTGACTTTGTGAGCGTGCGCTGTGCCAAGCGCCGAGGCTCC
ACCTGTGTGCTGGCTGGCATGGCCACAGACTTCGGGAACATGCCTGAGCAGAAGGGTGTC
ATCAG
gtaatacgggcagcaggctccaaacccccctcttctaacacaggcctgcaggtgtgcacc
caagcatgtggactgcatccccagctccaagaaaccaacccttggtgcacccatggcttc
cttctacaaaagaagatacttatttaccaaaggagggacaaagacaagataggccctact
EXON 6  94 bp
ctgatgagctggtaactgtgccaactgccaaataattaccctttgcaaagggcacttccc
tgatgagactcagaaaagacaaggtaccgtagaaacgtgttatctatggtactggtgtaa
gcagccagtgcaagagagaactcgcaactgtcctcctgacttgacttctccatttgccag
GGCGGAGCACGGTCCCACTTGCATGGTGCTTCACCCGTTGGCTGGAAGTCCCTCTAAGAC
CAAACTTACGTGGCTACTCAGCATCGACCTCAAG
gtgaagggcatgggagggggacctggaaggcaggtggtagtgagaaaaacaggctcttcc
cattccccccatgctgcagaaagaatcctcttctattctgatagaatcacaggctgtaag
acagggaagggtctggagtgatggcctaactgctactctaccatctccaaagcctgtgat
EXON 7  735 bp
gaaagtcatgacagcagaggagcaatgcagtcctcccgcccttgactgggcaactccaag
gctgcacctattaacagagctcgaagaccaagcccctggcagcctgtttgtgatagggtg
cagtgtcaagagtgggccaaaacccacaagatggccaaattctcctacctcctactgcag
GGGTGGCTGCCCAAGAGCATCATCAACCAGGTCCTGTCCCAGACCCAGGTGGATTTTGCC
AACCACCTGCGCAAGCGCCTGGAGTCCCACCCTGCCTCTGAAGCCAGGTGTTGAAGACCA
GCCTGCTGTTCCCAACTGTGCCCAGCTGCACTGGTACACACGCTCATCAGGAGAATCCCT
ACTGGAAGCCTGCAAGTCTAAGATCTCCATCTGGTGACAGTGGGATGGGTGGGGTTCGTG
TTTAGAGTATGACACTAGGATTCAGATTGGTGAAAGTTTTTAGTACCAAGAAAACAGGGA
TGAGGCTCTTGGATTAAAAGGTAACTTCATTCACTGATTAGCTATGACATGAGGGTTCAG
GCCCCTAAAATAATTGTAAAACTTTTTTTCTGGGCCCTTATGTACCCACCTAAAACCATC
TTTAAAATGCTAGTGGCTGATATGGGTGTGGGGGATGCTAACCACAGGGCCTGAGAAGTC
TTGCTTTATGGGCTCAAGAATGCCATGCGCTGGCAGTACATGTGCACAAAGCAGAATCTC
AGAGGGTCTCCTGCAGCCCTCTGCTCCTCCCGGCCGCTGCACAGCAACACCACAGAACAA
GCAGCACCCCACAGTGGGTGCCTTCCAGAAATATAGTCCAAGCTTTCTCTGTGGAAAAAG
ACAAAACTCATTAGTAGACATGTTTCCCTATTGCTTTCATAGGCACCAGTCAGAATAAAG
AATCATAATTCACAC
aaacatcagtctttgttttaatattgtactgttaaaaaaatctatgcagctgggtgcagt
ggctcacgcctgtaatcccagcattttgggaggctgaggtaggcggatcacaaggtcagg
agatcgagaccatcctggccaacatggtgaaaccccgtctctactaaaatacaaaaaatt