Gene ST18 Variant 1
DNA : 298.90 KbNT_008183
mRNA : 6187 bp NM_014682
CDS : 3144 bp NP_055497
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  62 bp
atcaccggaccgctggagatgtgactgggctcgggacatgagcccgcttgttcgctcact
ctcagtgaaaagagttttgaaatgagttctgaatagacagcattttctttgtgcggttgg
taaataacacagagcaaagttagcaagttgcagcgcctctgcgttctgattctatggaac
CTTTTTGTAGGGAGAAGGGCAGGATGTTTTTAACTGAATGTGACCTCAGGGGAATACTAG
AG
gtaaggagagaaaaataattgaggtaactgtgggtgttttacatctcggaaaccatggct
tttaataaggccacatgaagagagaagctggcatcatcccacgcaaaaaccagtgcctgg
cagagttgtggaaggtgctatcacattggcttggcatttgtgtagctttgattgaaaatc
EXON 2  125 bp
aaaccatggcttttaataaggccacatgaagagagaagctggcatcatcccacgcaaaaa
ccagtgcctggcagagttgtggaaggtgctatcacattggcttggcatttgtgtagcttt
gattgaaaatcaatggttttcttatgataattttcacatcatattttttttcttctttag
AAAATAATAAAATTTCTGAATGGGGCAGCGTGGAGAAATCCTAAGAGAAATAGCATAAGA
GCATTTTGGAACACATCCAGGAAAAGATAACTTTCGACACACCTGTAGACGTTCGCCAGG
TAAAG
gtaagaaaaaatattgtaaaatgcatttaagttattttattacatcgcactgggttgaac
tttgagagaaaacataccactggcgcaagatgcgcaaggaggagttaggagggctcacct
tttgcccctccctctcgtgggcatgggcatggcagccctgtgtccaccatgaccatcagc
EXON 3  46 bp
aaatgaatattgtttgactattgaagattggtaatacttcaacccatattccaatagtca
gcatggaaattacttgaaaggatggttttatatagttaataagctgtagataaataccat
ttaattatgttttctttttgtttttctttccatttttcctcctccgatgcttttcctcag
GAGTGATGGAAACTCTCCAGTTCAGATCCAGTAGCTTTTAGGGAAG
gtaagtaaaagctatttaaaaataaacttttcccccaaagaaaaagaatctccaactttt
caacatccatcaaaaacctgagaagttaaggaacttcattttagaggaccagaaaagatg
cttgctttggttattgttggcatcctcatggtaatttgggttatgttcatatagattttt
EXON 4  154 bp
ctgaactgagggcgcaatagaataggccaaaaacatttggagagaaagccgttttttttt
ttttagttgcaatcaaacgcaaactaagaattcccaagctcctgtgctacttttcaattc
ttacatcatgtgcagtaatctgctctatcacttgagagttttatctccatttttccccag
GAACTACAGTTGCTGACTTAAGTTGAAGAAGCATCTATTTAATGTCTGGTCAAATCCTAC
AAGAAACACAGAAATCTATGATTAAAAAGCTGAGCACTTTGATATACTGCAAAGGGTAGA
GAAGGCAGGACGGTAGAAATTTTCTGCAAGAAAG
gttggtggcttgtgttttaaaacatcagaactgccagacataaacattttaaatgtgcat
ggatacacgtgatgtttgtataaattggttcctctagtatgttgagtgcacgacactgaa
tttcaaagttttctctcaagggccaaatagcctgatgaaaactgattctgtgctcatccc
EXON 5  108 bp
aactatttttccccattgatacatagtataaaaattgtcattctatttctactgtagtac
aatcaaactatagataagtgtcaacactttgttgattgttcatttaagtgtttattgctg
ctcttctatttatttgtccagcctgatatgcttttcttgtttgatttcttatctcaatag
AATGAATTTCAGGATTTATCACTAAATAAGACAAAGTCATTTATTTAGTCCCCCTGACAC
AGCAGGGCAAACTGAGTTGACATACAAGTTACCTGGAGAAAAAGAGAG
gtaaggcgacatttttatttattaaaaagtagaacatgttgaaagaaaatgaattcaatc
aaagaatttatacgaaagctctcctctacaacagctctttctctgtggattcgcttacaa
atttattgttagtgttgaatttagaattgcaatttttgtcagaaatacagccatttaata
EXON 6  156 bp
ttgtgtttttgtttttgttttatttgccattaggttaaaatagaattttaagtgaaaaat
aaaatctaagggaaataaaacctccccacatgtcagtaattggcttgtgtgaatgaaagc
aaaactgagtttatgaattctatgtcctgctccttgaatctcttccctcccacaaaacag
CAATTCCAGGACTTCCTCTTCAGCCTAAAAGAAGGTACCAGATCTGTGCACTGGGGCGAT
GTGGAAGAGACCTGCTTATTGCCCCTGATGTAAGCTCCAGTAAGAAAAGACGTCAAGTAC
AAGTACTAGGAAATCACTTTATACATCTGTTTATAG
gtttgtaagtacataaagatattaaatgagagctttccaaattcaacccaagagttcaat
ttcattttctggtcatttttcttcctcattgtgtatctgcttatttccatcattagctct
tgcatgttttcctccaagttttgcttttttggccttctttattttgtacatgtcttttcc
EXON 7  88 bp
ctgttctctctggtttccagcaactgtagatgtatttccaaagctggtggtatgtggggg
gagtcacagttatgtactatagagccgggctgtgagtcaagagcatggaaggctactgtt
tttcataatgaccttcagaacttctaattacatgttttcatattttggtcaatgtcaaag
GAATGACCTCAGGACTTTGTGTTCATGTTATAGATGGATGCAGAGGCTGAAGATAAAACG
CTGCGTACTCGCTCTAAAGGAACCGAGG
gtgagttagcaagcaggttctatgacactatgcccaccacaccatgaaatatgagcgttc
cagtgctcagtccctcgtgtgcagtcagaatgattacaacttcctcagggcttctttttt
caaatcaagccaggacactggctcttggcacggagaggcaaaatattatgaacgaggagt
EXON 8  31 bp
tctgttctgggccatatccatctgtcctctcatctccaaagaactagaacaagaaaagat
gaacccacccagtgagaaacttattggtcgttacctctaggtgggggaaaagtttccatt
atacagttttgaaaattatcaactgattaagtcttcttttttttcttcttttgtcaacag
TGCCAATGGATTCACTAATCCAGGAGCTCAG
gtaagatttaccctatattacttttttttcacattaatgggccttgattattcgaatgat
ttgtacttttcaagcctcagaatactttttttagcagaaggaattggctaaagggctttt
tccatccagacgttgtgtatgcaccaagaaggcggaggagaatgattgtactgatactcg
EXON 9  191 bp
atagaatccacacagttcagtggagtccacagatgggatgtttttgttagtgccagtaac
caaccctaaacctctagtcccaagtttccaaaggctttaggttagacttcatgaaagtta
aatgccaaacagcagtaaatgctaatttaccatattcttaattttcctcaatcactacag
TGTTGCCTATGATTGCTCCATGGCAAAGAAGAGAACAGCTGAAGATCAGGCTTTGGGGGT
TCCAGTCAACAAAAGGAAATCCCTGCTAATGAAGCCCCGACACTACAGCCCAAAAGCAGA
CTGCCAAGAAGACCGCAGTGACAGGACAGAGGACGATGGCCCCTTGGAAACACATGGTCA
CTCTACCGCAG
gtagcaaggaggagagcccaaactttacctgctccctggctccaaggactctgtgctaat
tcatgtagagtgtgtggtttgtatggtttgtatggttgtaaaagtacattaagatttgga
agcaaaatgaaacatttattttacttgacattcatttattgaggacccagtttttaatca
EXON 10  792 bp
tgtttataaaattaatagagatgatatattacacatattatgtatgtatatgtgtacata
tatgtatgtgtatgtacctatgtatgtgaatgcatatgtttatatacatataacttgttg
caattttcctaaaatattttttgttcttgctcttcaaatattggttttctttttccatag
AGGAAATCATGATAAAACCTATGGATGAAAGTCTTCTTTCAACTGCACAAGAAAACTCCA
GTAGGAAGGAAGACAGATACTCTTGTTATCAAGAGCTCATGGTCAAGTCTTTAATGCACT
TGGGGAAATTTGAAAAAAATGTATCTGTTCAGACTGTAAGTGAAAATTTAAATGACAGTG
GCATCCAGTCTTTAAAAGCAGAGAGCGATGAAGCAGACGAGTGCTTTCTGATTCATTCTG
ATGATGGAAGAGACAAGATTGATGATTCTCAGCCACCCTTCTGCTCCTCTGATGACAATG
AAAGTAACTCTGAAAGTGCAGAAAATGGCTGGGACAGTGGCTCCAACTTCTCAGAAGAAA
CCAAACCACCTAGAGTCCCAAAGTATGTTTTAACAGATCATAAAAAAGACCTATTGGAAG
TTCCTGAAATAAAAACTGAAGGTGACAAATTTATCCCTTGTGAGAACAGGTGTGATTCTG
AAACAGAAAGGAAAGACCCGCAGAATGCTCTCGCAGAACCCCTGGATGGCAATGCCCAGC
CCTCATTCCCTGACGTTGAGGAGGAAGATAGCGAGAGCCTGGCAGTAATGACGGAAGAGG
GTAGTGACCTGGAAAAGGCCAAGGGGAATTTAAGTTTGCTGGAGCAGGCAATTGCTCTGC
AGGCTGAGCGAGGTTGTGTTTTCCATAACACCTACAAAGAGCTGGATAGGTTCCTGCTGG
AGCACCTAGCAGGGGAAAGGAGGCAAACCAAAGTTATCGACATGGGTGGAAGACAAATCT
TTAACAATAAAC
gtaagacacatttttgcatttattttaggaataaaagtgcattagggtttgaaaaaaaag
tcagatttgattatttttttcaggtagctttttaacagtttaatgcaacttaaaaatcaa
tttataattataaaataaacaatttctttcttttcccccactctctagattatcctccaa
EXON 11  135 bp
gaaaacatgttttccgtttccacaggtcttagttgagggtcttgttcaaggcgatgtgag
aagaatgtttataacggtaaaactgaataaagtgagaatgtcaccctgcaaggccattct
attgaatgggaagaaaagcaagaataaccaaatgcatttctcaattgaatttctccatag
ATTCACCAAGGCCTGAAAAGAGGGAGACCAAGTGCCCGATCCCTGGATGTGATGGCACGG
GACACGTGACAGGGCTCTACCCGCACCACCGCAGCCTTTCGGGGTGCCCCCACAAAGTGC
GGGTTCCCCTGGAAA
gtgagtaccacttgtccctcaaagcttctgcttatgcacgccagatcatcaagatgttat
cctctttgtctcccaatttggaattaggaatggaaacaaacttttttaaactatgtcaag
ccaattccatctagctgtgggttttaaaatatagtgtatttatagaaaattcaaggtgca
EXON 12  91 bp
ttgctggatttaatttctgaagttcttccatgctcacttgtttgtgtctgaatagagaga
gagagcatggtggatgatggaactgaagtcatttaaatgcaaagttgagagatacacgtg
ttagtgtgctttgtatttatggtaaagtattctttcctttatgtgttgttttgtgcttag
TTCTTGCCATGCATGAAAATGTGCTCAAGTGTCCCACGCCGGGATGCACAGGAAGGGGTC
ATGTGAACAGCAACCGCAACACCCACAGGAG
gtaattctcattagatgataatcattttgcatttaaaaaatgtggtagaaacgttccacc
aataaaataatgggttaccaatgtgtgatgaaaattgctgcatcactgtccaatatgtga
cacttgaaatagagaagaaatattctcagcatgtgcattgtcaaaaagaaaggacctcat
EXON 13  105 bp
caagtgttgacactgtagtttgcaaaaccctttgggatctttcagtgtgtgcgtggtgct
aagtgaactattaatatgacttaacatttagtgtgtgccaagtgtgctgtgaggcacatg
ccaaaacaaatcatattatcattttaactaaaatcctcctgtgtttctttttttaaacag
TCTTTCTGGTTGTCCAATTGCTGCAGCTGAAAAATTGGCAATGTCCCAGGATAAAAATCA
GCTTGATTCTCCCCAAACTGGGCAGTGTCCTGACCAGGCCCACAG
gtatgaacccctaacgatgttctcagtgctctcttcatccaggctcctgcacagcggggc
ctctggtccttcatgagtcagttctctgtggcttgacctcccctctcagccccagtagac
ctgggtgtgcagcccactccactagaccagaggctggtctagttaatgacatcgttgctg
EXON 14  194 bp
ctcgccctatgggtccggagcatgctgctctgtcctgccatggccccgtctctcttattg
ttcagtgtctctgtggataccttcaggagtgacacatgtatctactgtaaattctgacac
taatgtgctcaccagtagtttcattgtatttcttttgaactgcttcacccccctctccag
GACAAGTTTGGTGAAGCAAATTGAATTCAATTTCCCGTCACAAGCCATCACCTCTCCCAG
AGCCACAGTGTCAAAAGAACAAGAGAAGTTTGGAAAAGTACCATTTGATTATGCCAGTTT
TGATGCCCAAGTTTTCGGTAAACGCCCTCTCATACAAACAGTGCAAGGACGAAAAACACC
ACCATTTCCTGAAT
gtaagctttgagctctaatgccgtttccccaaaatgcttcttgtgtatgggtgtatgtgt
gtactgggggccagggggctgtacttaaatatatgatatactacatacagctggcaggag
agaaaatatattcaagtgaaataccataaagaaaacgataataagttgatcaatgttatt
EXON 15  212 bp
tgaatctctgtgaaaaccggtctggataaccttcatttaatgttcccatggataatggaa
cgtgttttaatttattcttcacatattttaatgcaagaagttacatttttaaaaaaaaca
aatctgtttaatgactaaaaccatgtacatgcaattgctaatcaaatctctcttcaacag
CAAAGCATTTTCCAAATCCAGTGAAATTTCCTAATCGACTGCCTAGTGCAGGCGCCCACA
CCCAGAGCCCTGGCCGTGCCAGCTCTTATAGCTACGGTCAATGTAGTGAAGACACCCACA
TAGCAGCAGCTGCTGCCATCCTGAACCTTTCCACCCGCTGCAGGGAAGCCACAGACATCC
TCTCCAACAAGCCACAGAGTCTGCATGCCAAG
gtaggccagtccaagagcccggagggtgggccagcgactgaactgtgagaataaactgcc
tttcatgttcctaactacattcactaccactctgctccccaacctctgaagcgatcccct
ccctgtctcaggaagaggctcagaggaacgcaggcagggatgagcttggtggggtcaaag
EXON 16  246 bp
ggctgttcttaaagtctgcctaagaattgaacattacccaacgcaaatcagaaagctaga
tttaaaagcagatatacttacataaaagcttacatttaaaatgatcccttaaaagcccca
catggctaggctgtaactgcaaactgcttaaatgtttttctgtttcctattgtataccag
GGAGCCGAAATAGAAGTGGATGAAAATGGCACATTGGACTTAAGCATGAAAAAAAATCGA
ATCCTGGACAAGTCTGCACCCCTAACTTCCTCTAACACTTCTATTCCAACTCCTTCCTCT
TCCCCATTCAAAACAAGCAGCATTCTGGTCAATGCAGCATTCTATCAGGCTCTTTGTGAC
CAAGAGGGCTGGGACACTCCTATCAACTATAGCAAAACTCACGGGAAGACAGAGGAGGAG
AAAGAG
gtattgtttccatatgtcaatcaataagttgaagacagcatgattgcagggtatcactag
cttttccctcctaaattatatttcacattcctgtttagataatacataattctgtacctt
gctttagattttgataaagtggtgatttttaatgtcagaggaaattcattaacaaatcca
EXON 17  116 bp
catcagccacctcgcctggcctatattatttatttcttatgcaaatcctctaaggtattt
cagccaagtccaagtccaaagccaaaactcaaacctggcttcaatgattttaaatctagt
tgtctttccagggttccctaatggcttctgtgttttgtttgttttttgtttgttttccag
AAAGACCCAGTGAGCTCTCTAGAAAATTTAGAGGAAAAAAAGTTTCCTGGAGAGGCCTCT
ATACCAAGCCCTAAACCCAAGCTTCATGCAAGAGATCTCAAAAAGGAACTAATCAC
gtaagtggtgcccaatgccatgccctctaagattctggaatgaagattcaagttcatgac
ttaaagttacaatatcctggcttatacagttgatgttagggtgatttctaccagtcagca
gttaaacgttaaacacgcatctaacctgagctaagagggtgtacatgatcttatgctaac
EXON 18  63 bp
ctttcaggtagtccactggttcttatataatataaatccttggtacactagcttctgcat
gtcctatactgtgttaacttatctcgcacagagaagctacctcctccgtaatctactggg
cagaggaaatgaacctgggaaatgcgcttgactctaatgatgtattttctattgactcag
CTGTCCAACACCAGGATGTGATGGAAGTGGCCACGTGACAGGAAACTATGCATCTCATCG
CAG
gtacccaatgacctcatgtgcagtcagattttcatggtcttgttctattttaaatactta
ttctcaccctttctatccatgtattatctgaagcaggaaatgagttggttgggtttttgg
tttattttctttttcagaaataaaattatgtgatataaaaatcatgattcttggtcaaaa
EXON 19  69 bp
gttgaagtgccaccagcccagactggcgagaagagcaaagccagattcaaagccagttat
ttttttttcccaatccccagtcaccaataatttaacgtatgttcacgactcaggatgcca
tttgactcagatttgtatatgtcagtgttgtgttgtgtttttttcctcatccctctctag
TGTTTCTGGATGTCCTTTAGCAGATAAGACTCTAAAATCCCTCATGGCTGCCAACTCTCA
GGAGCTTAA
gtaagtgcgggaagcgtggccggcttgcccttcatccacacggtaggaccctctcgttca
gtgcccattcattgcccaagtgatcagcaacaagcagtatgtcctgcctgccaggatcac
agcaaaggcactttctgactaaagcgctgggatgactgaaacaaaatcactgtaatttaa
EXON 20  63 bp
acacagaaagcagctctttgtttttagttacatttggctgtgtgaccccgcctccctcca
cgtgaactacagagacttggaacattaatgtgattactgaagaacctaaataacttgagt
gtgacccccactcccccaactacaacttctcagcccatgctctcttcctgtgccttccag
GTGTCCAACCCCAGGCTGCGATGGCTCGGGGCACGTGACTGGAAACTATGCTTCCCACAG
AAG
gtaggattgatcttatttctgagatgtggaaatgagcttgtcggcagcagtcagagagat
cacataattttgctttgttctttgtcgggtccctatttcagcttgtccggatgccctcgt
gcaaggaaaggtggtgtcaaaatgacccctaccaaggaagaaaaagaagaccctgaactg
EXON 21  81 bp
ttcctgtgccttccaggtgtccaaccccaggctgcgatggctcggggcacgtgactggaa
actatgcttcccacagaaggtaggattgatcttatttctgagatgtggaaatgagcttgt
cggcagcagtcagagagatcacataattttgctttgttctttgtcgggtccctatttcag
CTTGTCCGGATGCCCTCGTGCAAGGAAAGGTGGTGTCAAAATGACCCCTACCAAGGAAGA
AAAAGAAGACCCTGAACTGAA
gtaagtgcaacagttgagacatgggggtcagctgtctcttgttggtaaaatgggagggaa
cttggttgggatgcaattgaacacggattgagtttcagggaaggtgtaccctattaaata
taagcaagagtcaaactatttggtggtttgagaaaagtttccaatttatatctacacttc
EXON 22  222 bp
aatattaagtgagataatgcatgaaaatcgcgtagctctgagcctgtttatgcaatgctg
ttttgctagttatggtggcatcttttattaaaactctataattgcatggtttgttctctg
gagagcataggactatcactgccttcttcctggctggtaatgtctctgctttctctctag
ATGTCCTGTGATAGGGTGTGATGGCCAAGGTCACATATCAGGTAAATACACATCACACCG
CACAGCTTCTGGCTGTCCTCTGGCTGCCAAGAGACAGAAGGAGAATCCTCTCAATGGAGC
CTCCCTCTCCTGGAAACTGAACAAACAAGAGCTACCACATTGTCCCTTGCCAGGCTGCAA
TGGGCTGGGCCATGTAAATAATGTTTTTGTCACCCACCGAAG
gtaacatgagttttctgtctttttgttgtagtgttgtgatcggttgtcgcctaggctgcc
ttggggagagggttgtgaacaaccccctaaaggttgttcactgtagcagttgagatgtca
taacatgaagtcttgctgtatagatactggatgagcatgaagaatgaaaaatgttattct
EXON 23  89 bp
tgagggcctttggcctttgctttaatgggtatgtattcattactctctacaaagagactg
tgggttataatgtaattaatcggcagcaaaaacacaaatagtaggttgtgaataaaacat
tttaatttttataagaaatcatatacatttcatacattagtacaatttctattttcacag
CTTATCTGGATGTCCTCTCAATGCACAAGTTATCAAAAAGGGCAAGGTTTCTGAAGAACT
CATGACCATCAAGCTCAAAGCAACTGGGG
gtaagagcacagggctggctgtcaccacctcctgcagggtgtagaccctggctccccaaa
gcgttccgtgtgtcaaagtattctctaggtgggaagcataattttaatgtacaagaagaa
aggtttcctcagatttgaactaaaattataactttgtttaaaaaccaattttttggtgtt
EXON 24  104 bp
accaataaattaaatctgtaacttctcttatccactttttcagaatcctagatatgcatt
gttttggtaaaaacactaaatgaaagtctcattttcaagtagcaaatcacaaattaaaca
tataatgactcatttgttaacagttttcagtttgaactaaggtagtcttactctttacag
GAATAGAGAGTGATGAAGAAATTAGGCATTTGGATGAAGAAATAAAGGAACTGAATGAAT
CCAACCTTAAAATTGAAGCAGATATGATGAAACTTCAGACCCAG
gtaaaaaaaagaagtaattcatgatccttaatgtaatcataatctttggtggaaacaaaa
cattgaaattttaaaacttgtgtgaaaatatatggtaacttagagtcaatatgctgagtg
tttctagattccataattattgtaaaattctgaataggtggatcatcccaggttaccatt
EXON 25  144 bp
atttgattccagcacttcaaacaatccagtggggctgcagcttcatgctgagaagttaca
cgcatgcatctctgcatctcttagtattcagatgcacttggtgcattttccttcagggag
aaaccttttacactccttccaaactccactactcacattcccaagttatttctgttgtag
ATCACATCTATGGAGAGCAACTTAAAGACGATAGAGGAGGAGAACAAACTCATAGAACAG
AACAATGAAAGTCTGCTGAAAGAGCTGGCAGGTCTAAGCCAAGCTCTCATTTCAAGCCTT
GCTGACATCCAGCTTCCACAGATG
gtaagttcaaggccagaaccttgccattccattacaagcatttgcagtgtcatcatgcat
ctacccacggggttgccacgactgagctttgaggagacctgtgagcagtcacagagtgac
cacacttcatcacagtctggcttggagtaatctccctctctgggaacatggtagatacat
EXON 26  2500 bp
agtgaacagatgaatcccacacacactccgtctctctccatcccctgcaaccccagcagt
catatgcacccttgccttccctcccgactcccggatcactgatcttcgatgtcactgggt
ccttcttttccctcagcctgaaccactgtgattgggtcaatgtgttttgtctccatttag
GGACCTATCAGTGAGCAGAATTTTGAAGCATATGTAAATACACTCACAGATATGTACAGC
AATCTGGAACGGGACTATTCCCCGGAATGCAAAGCTCTACTGGAAAGTATCAAACAGGCA
GTGAAGGGTATCCATGTGTAGGATCACAGCGCTGCCGGGCAACAGAAGTTACCAACAGCA
GTAAACTCCAGATGGATCTGTTAGAGGTTCATGTACTGCTAAGGCGTGGAGGTTGCCGTA
CTGCATTTACAATTTGCAACATTGCACTAATTTTATTTTCCCCAGCTGATATAAAAAGGA
AAGAAAAACTATGATAGACTTCTTGGATTAAAAGCAATGCAGTCAATTATTAGATCTTAT
TTATTTTCATATGTTTTTCTTTTATTTCTTCATTGTACTCTTTTTTTTTTTGTAAAGTAT
ATGTAAAATAAATGTGACATTTTTATAATTTATTTATTACTAATCAAAGAGTTTTTTATC
TTTTAACTGCATTTTGAAGTCTGCCGTATTTTTACAAGTGTGTTTATTAATTTATTTTCC
AATAGGATTTAAATAGAAATGCTATTCTCAAGTCATCTTTCTTGCTGGGTTTTAATGAGG
AAACAGGAAAGGGTGAAGGAAATCCTTGTCTAAGGACTGCACTATAGTTGAGTTTGATTT
TTATTGCACACTTCTTCCCCCACCTTTCACTGATTTTTGTATTTATAAATGAATTTGCGG
TAAGGTGAGCTGCACGGAAGGAATAAGAAGACAAATGGCGCCCACTAGTGGGGAATCCGC
ACTCACAAAAGCACAGGATGCTGGAAAACAGCCTGCTCAGAATTTGTTAGCAATAATTAA
ATATAGCAATCAGCAAAGTATTCGACTTGGCTGGACGGTTTTCGTTAATATGAATTATTT
ATTTGAAATGTTTTAAAGAAACATAAGCCTTTTTAGTGATGCAGATTTGTCTGTTTGTTT
TTCAAGTCATATCAGATCGTTGGCAACTCGTATCCCAAGATGAAAAATAAGACTTGGTGT
GACCAGCCAGGCTTTCCTGCCATATGTTGGTACAATATACAAGTGACAATATTGGTGTAG
ATTTGTACTTAGCAAATACAAACACATCCAAATGAAAAATTTTGTAGATACCATATCCCC
TGAAATAGCATTTATCTTACTGGGTTGACTGGAAAGGAATGGAAAATATAGTAACACATG
AAAAAATGCTACTCCAATCTGAATGATTACTTCAAACACTGGCACCTTGGGTCTCACCCA
CCATAGGAAACAAGACAACATTCAATTTGATAGAAATCTTGCCACAAAACTTCAAATGCT
ACAAAATATACACACACACTCACACACACAGGCATACTCACACACAGACACACACACACA
CACACACACAGACTCATCCACACTTCAAATTGAGCCCACAATCTTGAATTTCTGAACGGA
TCAGAGTTTCATAGTTTCTATAGTAAAGGCAATGTCTATTTCAGGGATTGTAAAGTAGTT
AAGCATTGTTTCAAAAGTTTTTTTATATTTATTTTTTTTAAGGAAAAGGTATAGACAACC
AGCTAAACTGCCTTTTTGGTGTGCACACACATTTCATGTGCAGACGTGCCTCTGTGTAAA
TGTACACATGAACTTCATGTGGGCTTAATTTTCTGTGCTATAAACAAAAGTGTTTATTTT
TTATTAACCTCATGGATATTTAGATGGAAAGTGATGGCATTCACAGGCTTGATGTATTCC
ACTGTTATTACTGTTACCTGCACAAATGAAAAACAATACTCAACAGTAATTCCACTCCCA
TGAAACTTTGGTCATTGTTATGCATTAAGTGGGGCTTATCTTTGGTTTGGAGTTCATTTG
AACTCTTGAACCTTAGTTTAGTGAAGATGAACTGTCTGTTCTTAGGTAGAAACGGTGTTT
ATTTAAAAATCAGTTTTAAAAAATGAGCTACCATATGTGCTGTCTATTATAAATGGGACA
CCAAACAAAATTTTCTATTACAGTTGTGTACTTGCAAACATTTTGCTATACAGTACTTCA
TAGATGCATACAAATGAGCTCACTTATTACAAAGACAAACGTTTAATTTGCTAAATATTT
TAACAAGTTTGTTATATATTTTATTTAATTTAAAAGAAATCTCTTACCAACCTACATATT
TATTACTATAATTTGCTATGACTTCAGGTTAATTTATTTGTGTTTGCATAGTTTGAGCAG
GATGTTTTGTGAAGTATGTTTGTATTTATTTGCCTACTTTGTACTTGATGTGTTTTGTAA
TGTGCACTGAATTTGTTTTCTTTTCAACTATGTTAATGATCAATACTGTAAATTGGGTCT
TTTGTAAACAAAAAGGCAATGATGTATGCATTTTTTTTAATTTGAGGTAGTTTGTTTGTA
TACTGTTTCTCCAAACACTTAATATTTCTTACATCAAAGCAACAAAATTGTGTTCAGTGC
TGTACATTTGGTGTATGGTAGGAAATAAAAATTGATAACG
agttttgatgtgatctttctcaggctgttatctggagactagtatccccttcccatggaa
tccactgtccagaacgagccctggtgaggtccccagagtgcacttgagcctgccagtcat
tcggagacatttctgttctgacagccggtttgcttgccttaaagtggacaggacttttgg