Gene PLAT Variant 3
DNA : 32.44 KbNT_008251
mRNA : 2654 bp NM_000930
CDS : 1689 bp NP_000921
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  183 bp
gacactaggactctaaaggaagatgattcttaaggtcccatcccacttccaaattcctgc
gattcaatgacatcacggctgtgaataatcagcctggcccgaagccaggatgggctgtgc
tgcttccaccgtgaacttcctccccctgctttataaaaacaggcctgcctcagctccctc
ATGGCCCTGTCCACTGAGCATCCTCCCGCCACACAGAAACCCGCCCAGCCGGGGCCACCG
ACCCCACCCCCTGCCTGGAAACTTAAAGGAGGCCGGAGCTGTGGGGAGCTCAGAGCTGAG
ATCCTACAGGAGTCCAGGGCTGGAGAGAAAACCTCTGCGAGGAAAGGGAAGGAGCAAGCC
GTG
gtaggtcgggtttctgtaccttggggtctgtctcctcttctttctcttaaaagtctttcc
agcaagctgagccagtgaaggaatgctttaaccaagggaccaactttgtaattcaggcaa
ctagaggatccgctagaatccactccagaggggagatgtctgtttgcatttgcatgtgat
EXON 2  98 bp
ttttgcaacaataaaaaatatgtagtttctagaatcctcttctagatgcatgtctggcgt
ttctgccgcggggctggcactggaggaagccagacaggacaacattgcggcttatcctcc
tctgttgccatcatggacctctcgcaccccgtgatcaagctgttttttctctccttccag
AATTTAAGGGACGCTGTGAAGCAATCATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGC
TGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCAGCCAG
gttggtgtgcaggatccctgtgtcccgcccctcaaggctgtgatgcttccggaggctcca
ggggtctgtgtccatctgggccacggaggttggaatgctgtcagggagcagagaggcaca
gggacgaggggctggcattgctgtggagcacacagcacacactcccttctgtacagcaaa
EXON 3  43 bp
ggagaggaagaattggactagaaggcaggagatggactttcacttgggccagttacccga
gggggtctctgagcagaggtatctggccggcaggttcacatgggcttctgggttggccgc
ctttactcttagtacacctggcatgtgctgatccttcctccacctctggtttcttcgcag
GAAATCCATGCCCGATTCAGAAGAGGAGCCAGATCTTACCAAG
gtcgggtgaagctgaggggtgcatggggtcatcagggagggaggcagggcggggtgcagg
gtgcatcacccacccaccacctgccttcttccacccaccacctgcctacggtgtgacagt
gccattgcagcatgattctacagagatgcctgtgtcggcaccattctcccatcagctgcg
EXON 4  138 bp
gtcaccgtgtttggccagtattcattatcttgttgtcttccagttgtgtctcttcaataa
gggagtatgcaatggagtctatagaaagcaagtgagggagttttctcagtaggtgcaagg
gtagtgaggcatttcattttgagtcatactctgatgaggctggcctgtcttttctcatag
TGATCTGCAGAGATGAAAAAACGCAGATGATATACCAGCAACATCAGTCATGGCTGCGCC
CTGTGCTCAGAAGCAACCGGGTGGAATATTGCTGGTGCAACAGTGGCAGGGCACAGTGCC
ACTCAGTGCCTGTCAAAA
gtatgtactgaggctgggaggtggtgcatgcctgtgatcccagcactttaggaggccaag
gtgggagggtcgctggagcccgggagttcaagaccaatctgggcaaacatagcaagtccc
ctgtctctacaaaaaataaaaaaattagccagacctggtatgtagtcccaactacttggg
EXON 5  111 bp
atttttttcaaccaaaggcaggatgaaaacagtatttgtaggatgcagaactggtatacg
cgtgttccacgctgcaggacttgagtgtgtgtggattgtggtagacagggctcctggaac
catggcctgagcacacagaaggaggctgtcattaggggcttccttttttatacttgacag
GTTGCAGCGAGCCAAGGTGTTTCAACGGGGGCACCTGCCAGCAGGCCCTGTACTTCTCAG
ATTTCGTGTGCCAGTGCCCCGAAGGATTTGCTGGGAAGTGCTGTGAAATAG
gtgagtaggtgagagcacgtgaaacgagctgaaatcccacctctccagtctcccccgccc
ccggaaggaaaggcagggtgcgatggcagggccaggggtgggggccagggacagggaagg
cgcttctgccatgggtcaggaagcacagtgccacacagcaagcagagcctaggtgtgacc
EXON 6  175 bp
cacagcaagcagagcctaggtgtgaccctgaatccaggctggcacccttgccacccagcc
tgtggcttccgagccagcctgcatcaggcctgggggaggacggggcagagaggggagcct
cctgagggctgaatgaaaggggactcccatgtgaggcatccatgccctgctctctgtcag
ATACCAGGGCCACGTGCTACGAGGACCAGGGCATCAGCTACAGGGGCACGTGGAGCACAG
CGGAGAGTGGCGCCGAGTGCACCAACTGGAACAGCAGCGCGTTGGCCCAGAAGCCCTACA
GCGGGCGGAGGCCAGACGCCATCAGGCTGGGCCTGGGGAACCACAACTACTGCAG
gtgagggcacatccccaaggagggattccccctgtgagaagctgctacagctggggaaag
attctgtcagatccgtcagggttctcccaagaaacataaccaatacaggatggatagatg
gatagatgatagacagataatagatgataggtgatagatgatagattgatagatgataga
EXON 7  92 bp
aacggaggttgcagtgagaggagatgcgccgctgcactccagcctgggataaacagcgag
actctgtcaaaaaaaaaagcaccccccattcctccagaaaaggataccaaagtccttggg
tcctaaaggagaggcttcacctttgacctaccctggcccttcccttggctgatttttcag
AAACCCAGATCGAGACTCAAAGCCCTGGTGCTACGTCTTTAAGGCGGGGAAGTACAGCTC
AGAGTTCTGCAGCACCCCTGCCTGCTCTGAGG
gtaagtggcagccaccccgcctttccctgaatgtccctgggggaggaaagtccaggagga
caggccgatagccctcctgcacctgaggggagaaagggggaggccaggagtgagtcattt
tggttgcagagggaagaaagacaggacttaggtctgtgcctgggcttggcctctgactgg
EXON 8  172 bp
gatcgcgcattgcactccagcctgggcaacaaaaggggaagtgtgaggtgttacactctt
ctcagtgccgggctagcggcctccagcttcctcgaccggcagctccgcttcaagccccag
ccctgacttgcgtgcttcagaatttgtttttgtttcagtttgagaattcttttcttctag
GAAACAGTGACTGCTACTTTGGGAATGGGTCAGCCTACCGTGGCACGCACAGCCTCACCG
AGTCGGGTGCCTCCTGCCTCCCGTGGAATTCCATGATCCTGATAGGCAAGGTTTACACAG
CACAGAACCCCAGTGCCCAGGCACTGGGCCTGGGCAAACATAATTACTGCCG
gtaggtagcacaggggtggggggttcaggtcttggcagaacgtgggattagggtgtgaga
cgggggaagatccaatgtctcaagttgcatgacagacccagtgcgtgggaagcacccatg
gatattatctaatccaacctcttcacttgctagaataacacatattgtgaaaagcaaggt
EXON 9  86 bp
actcctggcctggtgtggtggtgcatgcctgtaatcccagcactttgggaggctgaggca
ggaggattgcttgagcccaggagttcaagaccagcctgggcaacatggcaagaccccatc
tctacaaaaattaaaaaataagaagataaaaaggaaaccttaaactctcttatcatttag
GAATCCTGATGGGGATGCCAAGCCCTGGTGCCACGTGCTGAAGAACCGCAGGCTGACGTG
GGAGTACTGTGATGTGCCCTCCTGCT
gtaagggctgggccccggctgcctccctgcacctggtctcccttcttcaccatctcctcg
ccactttctaggccttcatggctgtctggtgcagactgtgtgcctaccagacttccaggc
tgggtggggagggggcttccatgactgaagccacggtgggtgggcgggtgtccatgaccc
EXON 10  196 bp
ctccgcctcctgaaacttatcgctgtgggaactaaagagaatgtatggacaacattcggc
atgctgatcccaccaagtgaaagttgtggttttacagccatgctgatggcctcctcactc
tacctacacacgtgcaggaggcctgtgggactgactgcctcctcgtcctttcctccccag
CCACCTGCGGCCTGAGACAGTACAGCCAGCCTCAGTTTCGCATCAAAGGAGGGCTCTTCG
CCGACATCGCCTCCCACCCCTGGCAGGCTGCCATCTTTGCCAAGCACAGGAGGTCGCCCG
GAGAGCGGTTCCTGTGCGGGGGCATACTCATCAGCTCCTGCTGGATTCTCTCTGCCGCCC
ACTGCTTCCAGGAGAG
gtaggggctcggaaacccagttggtttttccaccctctaacgcctagaaaccaagccctt
taggggaaatcccacagcaaaaaaagcattctaaggctgtttctccaccaggtttccgcc
ccaccacctgacggtgatcttgggcagaacataccgggtggtccctggcgaggaggagca
EXON 11  137 bp
gttcctgtgcgggggcatactcatcagctcctgctggattctctctgccgcccactgctt
ccaggagaggtaggggctcggaaacccagttggtttttccaccctctaacgcctagaaac
caagccctttaggggaaatcccacagcaaaaaaagcattctaaggctgtttctccaccag
GTTTCCGCCCCACCACCTGACGGTGATCTTGGGCAGAACATACCGGGTGGTCCCTGGCGA
GGAGGAGCAGAAATTTGAAGTCGAAAAATACATTGTCCATAAGGAATTCGATGATGACAC
TTACGACAATGACATTG
gtaagagctcgtcattcccggctccagttcatacagatcacacaacacacccacatgcac
tcacctatgtttacacacacgggcctcctcctccagcccctgcccctcctgcgtgttcct
cccctcccggggacgcggccctcacgccagctcactcctcctttctccctcccagcgctg
EXON 12  141 bp
cattggtaagagctcgtcattcccggctccagttcatacagatcacacaacacacccaca
tgcactcacctatgtttacacacacgggcctcctcctccagcccctgcccctcctgcgtg
ttcctcccctcccggggacgcggccctcacgccagctcactcctcctttctccctcccag
CGCTGCTGCAGCTGAAATCGGATTCGTCCCGCTGTGCCCAGGAGAGCAGCGTGGTCCGCA
CTGTGTGCCTTCCCCCGGCGGACCTGCAGCTGCCGGACTGGACGGAGTGTGAGCTCTCCG
GCTACGGCAAGCATGAGGCCT
gtaagtggaaggaagtctcggccccatcctgtctgcgggacagcaggggaggctgcggtc
caccagaggaaaatggggtcaggagaccgaagttccagccccgggtcaggcactgacgcc
agtcccgtctccctgtgtcgtgggggcccgtctctgctgtctctgcctcacagggacact
EXON 13  167 bp
cccggaatcctgctgtttttgtgggtcaaaacgataaaataccagcagtgtcataggatt
cgacctaatacatgttgaatcttgatcaatgttagctattattggaaaatttggctttct
ctttcaaaaacgtttataaataactttccctaaaaccatatgatggttctcccctttcag
TGTCTCCTTTCTATTCGGAGCGGCTGAAGGAGGCTCATGTCAGACTGTACCCATCCAGCC
GCTGCACATCACAACATTTACTTAACAGAACAGTCACCGACAACATGCTGTGTGCTGGAG
ACACTCGGAGCGGCGGGCCCCAGGCAAACTTGCACGACGCCTGCCAG
gtaaccaggagtggcgcgcccatgctgggcacaacccaggggagaatgcccctgggacaa
caggttcttcaccaaagaaaaaagttatcaccagagtggagtgatttcctcttagtgata
cccctggggattctagatgagggcctcacagaataaagcaactggaggaagatcaaagtc
EXON 14  915 bp
tccccagacaggaattgatttttgttttcctcatcaaagttataatgaaatgacactgaa
tggaatattattgaagggcctgctgtattttgaagattacgatgttcatgctacacatac
tgactttctccagatagtctgctttttttgcaaacgccaaacctgctatctcctttgcag
GGCGATTCGGGAGGCCCCCTGGTGTGTCTGAACGATGGCCGCATGACTTTGGTGGGCATC
ATCAGCTGGGGCCTGGGCTGTGGACAGAAGGATGTCCCGGGTGTGTACACCAAGGTTACC
AACTACCTAGACTGGATTCGTGACAACATGCGACCGTGACCAGGAACACCCGACTCCTCA
AAAGCAAATGAGATCCCGCCTCTTCTTCTTCAGAAGACACTGCAAAGGCGCAGTGCTTCT
CTACAGACTTCTCCAGACCCACCACACCGCAGAAGCGGGACGAGACCCTACAGGAGAGGG
AAGAGTGCATTTTCCCAGATACTTCCCATTTTGGAAGTTTTCAGGACTTGGTCTGATTTC
AGGATACTCTGTCAGATGGGAAGACATGAATGCACACTAGCCTCTCCAGGAATGCCTCCT
CCCTGGGCAGAAAGTGGCCATGCCACCCTGTTTTCAGCTAAAGCCCAACCTCCTGACCTG
TCACCGTGAGCAGCTTTGGAAACAGGACCACAAAAATGAAAGCATGTCTCAATAGTAAAA
GATAACAAGATCTTTCAGGAAAGACGGATTGCATTAGAAATAGACAGTATATTTATAGTC
ACAAGAGCCCAGCAGGGCCTCAAAGTTGGGGCAGGCTGGCTGGCCCGTCATGTTCCTCAA
AAGCACCCTTGACGTCAAGTCTCCTTCCCCTTTCCCCACTCCCTGGCTCTCAGAAGGTAT
TCCTTTTGTGTACAGTGTGTAAAGTGTAAATCCTTTTTCTTTATAAACTTTAGAGTAGCA
TGAGAGAATTGTATCATTTGAACAACTAGGCTTCAGCATATTTATAGCAATCCATGTTAG
TTTTTACTTTCTGTTGCCACAACCCTGTTTTATACTGTACTTAATAAATTCAGATATATT
TTTCACAGTTTTTCC
aaaatcagagtggaatggttttgttatagatgctgtatcccactctttattcatgttcac
attttaaaatcatttggaattctgcttcactcgcttaacatatacacaacacctgtaaca
tacaaggcaatgggctaggtgctccagaccgggaaaaggagggacaggaatgcttggtct