Gene OPLAH Variant 1
DNA : 12.61 KbNT_023684
mRNA : 4095 bp XM_291266
CDS : 4095 bp XP_291266
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  235 bp
aggtcagaggtcaggccacctctgccacggggtggttggaacagctgggtcctgaccctg
aaggcccggaatgcggctgaggcgagggggcaggggcagctgctgacctcacaatagcag
ggtctgctgtccctggccggcctgctggcccccgccagctgccgccgctggctgccaggc
ATGTCCCTCCTCAGCAGCTATGAGGGCCTGCGGCAGGAGATCCAGCGGCTGGCACAGGAG
AACGAAGAGCTGCGGCGGCTGGTGCAGCTCATCCAGGAGAACCAGGAGCTGAAGCTGGTG
CTCAGGAACCGCGGCAGCAGCCTGGGCTTCTGCAGCTCCGGGTTCCTGGCTGAGGTGGCT
GCCAGTCCCTGGCTACCCAGGCGGAGAACGATCAAATTCAAGAATGCTGAGAGAG
gtgagccgtaccggggccccaagactctgtggagttgggcaaacccgctgggtgctgcgg
tgcctctggagcaaagccagggccctggggctcttccaggatgtgcggcggggagaaggt
gccaggtctgggaaagtgacctctgagcagagcctgagcgggcgagggagctgccaggct
EXON 2  215 bp
ggccaggctctcgctcgggcccaggctgccctcggagctgggcctgcggctctggctctt
cccagagtcgtgcccgtgggtctctccctcaggaaccccccgcatgcgcagggctgggga
gcctctagtcccactcgcaggtgagcccgggctgaccccgcctccgtccagtttttccag
GGCTACCAGCTGAAGAGCTCCTGTGGGACTCCAGCCCCACCACCATGGGCAGCCCCGAGG
GCCGCTTCCACTTTGCCATCGACCGTGGGGGTACCTTCACAGACGTCTTTGCCCAGTGCC
CAGGGGGGCACGTGCGGGTCTTAAAACTGCTCTCAGAGGACCCTGCCAACTATGCGGACG
CGCCAACCGAAGGCATCCGCCGCATCCTGGAGCAG
gtgggccagggcggagcgggtggacagggaccccacggccagaagccccacactgaccac
gtggtccccaggaggccggcatgctcctgccccgggaccagccgctggactccagtcata
tcgccagcatccgcatgggcaccacagtggccaccaacgcactgctggagcggaaggggg
EXON 3  192 bp
ctttgcccagtgcccaggggggcacgtgcgggtcttaaaactgctctcagaggaccctgc
caactatgcggacgcgccaaccgaaggcatccgccgcatcctggagcaggtgggccaggg
cggagcgggtggacagggaccccacggccagaagccccacactgaccacgtggtccccag
GAGGCCGGCATGCTCCTGCCCCGGGACCAGCCGCTGGACTCCAGTCATATCGCCAGCATC
CGCATGGGCACCACAGTGGCCACCAACGCACTGCTGGAGCGGAAGGGGGAGCGGGTGGCG
CTGCTGGTGACACGTGGCTTCCGAGACCTGCTGCACATTGGCACCCAAGCCCGTGGGGAC
CTCTTTGACCTG
gtgagctccatgttggctggggaccaggctgtgtggtgtacaccccccagggatgccttg
accctgtggggagagcagttgttggattagtgatggctcatgggcaccagccgacaaaga
ggaagctcccgaattcccagtgggaccccaagttctcctagccctcggagtgggcacagg
EXON 4  100 bp
tgcctagggggtggagagctgcccccttggtgagccttgctggggctgccaggtatgact
ctcctgggcctgccgaccggcctgttgggacacagccactcacctgtaccacccactcac
acaggaccccggcctggaccctcaggcctgggcctcttctgagtctctgcccgcccccag
GCCGTGCCCATGCCTGAGGTGCTGTATGAAGAGGTGCTGGAGGTGGACGAACGCGTGGTG
CTGCACCGTGGAGAGGCGGGCACCGGGACGCCTGTGAAAG
gtgtgtgtgccgccgctgctgtgggatttggggccggagggtcctgctggcctttaacgg
ggcctcctgggcttttctggaaggccgcacgggggacctgctggaagtgcagcagcctgt
ggacctgggggccctgcgtgggaagctggaggggctgctatctcgaggcatccgcagcct
EXON 5  124 bp
gtgcccatgcctgaggtgctgtatgaagaggtgctggaggtggacgaacgcgtggtgctg
caccgtggagaggcgggcaccgggacgcctgtgaaaggtgtgtgtgccgccgctgctgtg
ggatttggggccggagggtcctgctggcctttaacggggcctcctgggcttttctggaag
GCCGCACGGGGGACCTGCTGGAAGTGCAGCAGCCTGTGGACCTGGGGGCCCTGCGTGGGA
AGCTGGAGGGGCTGCTATCTCGAGGCATCCGCAGCCTGGCTGTGGTGCTCATGCACTCGT
ACAC
gtgagtgaggtggggctgtgggctgcgggagcaggtgccgggcctggtgggagacgaggt
gccactgggtttttgtcataggtgggcccagcatgagcagcaggtgggtgtgctggcccg
ggagctgggcttcacgcacgtgtcactgtcctcggaggccatgcccatggtgcgcatcgt
EXON 6  196 bp
gcagcagcctgtggacctgggggccctgcgtgggaagctggaggggctgctatctcgagg
catccgcagcctggctgtggtgctcatgcactcgtacacgtgagtgaggtggggctgtgg
gctgcgggagcaggtgccgggcctggtgggagacgaggtgccactgggtttttgtcatag
GTGGGCCCAGCATGAGCAGCAGGTGGGTGTGCTGGCCCGGGAGCTGGGCTTCACGCACGT
GTCACTGTCCTCGGAGGCCATGCCCATGGTGCGCATCGTCCCTCGGGGGCACACGGCCTG
TGCCGACGCCTACCTCACGCCCGCCATCCAGCGCTACGTGCAGGGCTTCTGCCGTGGCTT
CCAGGGCCAACTCAAG
gtgaggctgtgaggcacccccactgcccactcctgggcctgggcctgggccttggcctgc
ccctcatggcccgcctgctgcccgctcgcaggatgtgcaggtgttgttcatgcgctccga
tggcggcctggcgcccatggacaccttcagcggctccagtgctgtgctctcgggcccggc
EXON 7  166 bp
ggcacacggcctgtgccgacgcctacctcacgcccgccatccagcgctacgtgcagggct
tctgccgtggcttccagggccaactcaaggtgaggctgtgaggcacccccactgcccact
cctgggcctgggcctgggccttggcctgcccctcatggcccgcctgctgcccgctcgcag
GATGTGCAGGTGTTGTTCATGCGCTCCGATGGCGGCCTGGCGCCCATGGACACCTTCAGC
GGCTCCAGTGCTGTGCTCTCGGGCCCGGCCGGCGGCGTGGTGGGCTACTCAGCCACCACC
TACCAGCAGGAGGGTGGCCAGCCTGTCATCGGCTTTGACATGGGAG
gtatgagggccgagggctggggtctcggggaggctcagctgctgggcccctgggtcttca
agtgacccaccagcaccccacccctgccaggcacgtccacggatgtgagccgctatgctg
gggaattcgagcacgtcttcgaggccagcacagctggcgtcaccctccaggccccgcagc
EXON 8  139 bp
tctcgggcccggccggcggcgtggtgggctactcagccaccacctaccagcaggagggtg
gccagcctgtcatcggctttgacatgggaggtatgagggccgagggctggggtctcgggg
aggctcagctgctgggcccctgggtcttcaagtgacccaccagcaccccacccctgccag
GCACGTCCACGGATGTGAGCCGCTATGCTGGGGAATTCGAGCACGTCTTCGAGGCCAGCA
CAGCTGGCGTCACCCTCCAGGCCCCGCAGCTGGACATCAACACCGTGGCAGCGGGAGGGG
GTTCCCGCCTCTTCTTCAG
gtcagctctcctgcttcccaggctgggaccccagccctgtctccctcctcgtgtccaact
ccaaccccagcccttccttcccctaggtctggcctctttgtggttgggcccgagtcagca
ggagcccacccaggacccgcctgctaccgcaaaggtaagagtcaggatctggccggcctg
EXON 9  68 bp
tcttcgaggccagcacagctggcgtcaccctccaggccccgcagctggacatcaacaccg
tggcagcgggagggggttcccgcctcttcttcaggtcagctctcctgcttcccaggctgg
gaccccagccctgtctccctcctcgtgtccaactccaaccccagcccttccttcccctag
GTCTGGCCTCTTTGTGGTTGGGCCCGAGTCAGCAGGAGCCCACCCAGGACCCGCCTGCTA
CCGCAAAG
gtaagagtcaggatctggccggcctggccttgccctccgcttgccgccgcaggcccagcc
cctcctgtcagccctatccctgctgcctactcctgctcccctgcctccagcccccaagcc
ccacaccctgtccacctcccagggggccctgtgacagtgacggatgctaatctggtcctg
EXON 10  266 bp
agcaggagcccacccaggacccgcctgctaccgcaaaggtaagagtcaggatctggccgg
cctggccttgccctccgcttgccgccgcaggcccagcccctcctgtcagccctatccctg
ctgcctactcctgctcccctgcctccagcccccaagccccacaccctgtccacctcccag
GGGGCCCTGTGACAGTGACGGATGCTAATCTGGTCCTGGGTCGCCTGCTGCCTGCCTCCT
TCCCCTGCATTTTTGGGCCGGGAGAGAACCAACCACTTTCCCCTGAGGCCTCCCGCAAAG
CCCTGGAGGCTGTGGCCACTGAGGTCAACAGCTTCCTGACCAACGGGCCCTGCCCGGCCT
CCCCGCTGAGCCTGGAGGAGGTGGCCATGGGGTTCGTGCGCGTGGCCAACGAGGCCATGT
GCCGGCCCATCCGTGCACTCACGCAG
gtacgtccacctctgctctcccgcctgtcctgcccccagccctgctccctgccccaggcc
tcctgctcaggctgggggctggatggggtagagtaggagagcccactgaccccttctgtc
tccctaggcaagaggccatgacccctcagcccatgtgctggcctgctttgggggagctgg
EXON 11  113 bp
tcgtgcgcgtggccaacgaggccatgtgccggcccatccgtgcactcacgcaggtacgtc
cacctctgctctcccgcctgtcctgcccccagccctgctccctgccccaggcctcctgct
caggctgggggctggatggggtagagtaggagagcccactgaccccttctgtctccctag
GCAAGAGGCCATGACCCCTCAGCCCATGTGCTGGCCTGCTTTGGGGGAGCTGGTGGGCAG
CATGCATGTGCCATCGCCCGGGCCCTGGGCATGGACACGGTGCACATCCACAG
gtgggcctgggtgtgggtgcacggaggtggtgtgatctgcgccgggcttgggaggtgacc
tcccattgccatgctgcccatccctgcaggcacagtgggctgctgtcggccctggggctg
gccctggctgacgtggtgcatgaggcacaggaaccctgctccctgctctacgcgcctgag
EXON 12  171 bp
cccatgtgctggcctgctttgggggagctggtgggcagcatgcatgtgccatcgcccggg
ccctgggcatggacacggtgcacatccacaggtgggcctgggtgtgggtgcacggaggtg
gtgtgatctgcgccgggcttgggaggtgacctcccattgccatgctgcccatccctgcag
GCACAGTGGGCTGCTGTCGGCCCTGGGGCTGGCCCTGGCTGACGTGGTGCATGAGGCACA
GGAACCCTGCTCCCTGCTCTACGCGCCTGAGACCTTCGTGCAGCTGGACCAGAGGCTGAG
CCGCCTGGAGGAGCAGTGTGTGGATGCTCTGCAGGCCCAGGGCTTCCCCAG
gtgggctcccagggtgccctggacagagggcttacgttgtcctcaccacgcccttggtgg
gtgttcctcctgatgacttcccaggtggtcccggggtgtgcgagaagcagaacaggtgtc
cttgccgggcgctgggtggggtggggtcagggcagggggtttggtgtgagtgcccccaac
EXON 13  138 bp
ggtgccctggacagagggcttacgttgtcctcaccacgcccttggtgggtgttcctcctg
atgacttcccaggtggtcccggggtgtgcgagaagcagaacaggtgtccttgccgggcgc
tgggtggggtggggtcagggcagggggtttggtgtgagtgcccccaaccacctgctgcag
GTCCCAGATCAGCACTGAGAGCTTCCTGCACCTGCGCTACCAGGGCACGGACTGTGCTCT
GATGGTGTCTGCCCACCAGCACCCAGCCACAGCCCGCTCGCCCCGTGCGGGGGACTTCGG
GGCAGCCTTTGTGGAGCG
gtacgtggcttcctgactccggatccctggcaaggggccctcctgtctggccgcctcact
ctgaccactccttgggtccccgcggggagtgcaggtacatgagggagtttggctttgtca
tacctgagcggccggtggtcgtggacgatgtgcgagtgcggggcaccggccgcagtggtc
EXON 14  139 bp
tgtgctctgatggtgtctgcccaccagcacccagccacagcccgctcgccccgtgcgggg
gacttcggggcagcctttgtggagcggtacgtggcttcctgactccggatccctggcaag
gggccctcctgtctggccgcctcactctgaccactccttgggtccccgcggggagtgcag
GTACATGAGGGAGTTTGGCTTTGTCATACCTGAGCGGCCGGTGGTCGTGGACGATGTGCG
AGTGCGGGGCACCGGCCGCAGTGGTCTTCGCCTCGAGGATGCCCCCAAAGCCCAGACCGG
GCCTCCCCGGGTGGACAAG
gttggtggtcctgcctgtgccagcctgacagcacccatggggcaccgggatggggaccaa
gccctgtgagaggcatcggggagggtgctgggcccgggcgctgtactcacccgcaccctc
tgcagatgacccagtgctactttgaggggggctaccaggagacccctgtgtacctgctgg
EXON 15  113 bp
tcttcgcctcgaggatgcccccaaagcccagaccgggcctccccgggtggacaaggttgg
tggtcctgcctgtgccagcctgacagcacccatggggcaccgggatggggaccaagccct
gtgagaggcatcggggagggtgctgggcccgggcgctgtactcacccgcaccctctgcag
ATGACCCAGTGCTACTTTGAGGGGGGCTACCAGGAGACCCCTGTGTACCTGCTGGCAGAG
CTGGGCTATGGGCACAAGCTCCATGGGCCCTGCCTCATCATCGACAGTAACAG
gtgggctgaagtccggccagggtggaggatgtggacgggtccactgcggggcccctggtg
cagggttctctggcccaaggctgcaggggcctgcaggactctgtatcccaccatcgttgg
ggtggcccctggcctggggccgtggcatctctggttggaggggtgtcgcctggccccatg
EXON 16  152 bp
gatgtggacgggtccactgcggggcccctggtgcagggttctctggcccaaggctgcagg
ggcctgcaggactctgtatcccaccatcgttggggtggcccctggcctggggccgtggca
tctctggttggaggggtgtcgcctggccccatgcagccctctgtgccctctgctccccag
CACCATCCTGGTGGAGCCAGGTTGCCAGGCAGAGGTGACCAAGACAGGGGACATCTGCAT
CTCCGTGGGGGCCGAAGTCCCCGGCACAGTGGGCCCCCAGCTGGACCCTATCCAGCTGTC
CATCTTCTCACACCGCTTCATGAGCATTGCTG
gtgagtggccgctgccaggctccctgtgggatgaggcgccggctgtgtcatggggtagct
ggcagggctgtgcccaaagggagaggcagaagcaggaccccctggcgacggggcgggcag
tgtggccgcagcactggtgtggtgcagttggccatgagaacaaaccttgggcagggagga
EXON 17  161 bp
ctttacataggctaagacgtggccaagtgggcacaccgtcaacttggtcttccccaggaa
aaagctgctgggtttttcctgggtcctgggtttgagtcctggtgggtcctgttcctccct
ttcctggggccaggctgtgggtgggtggggccagcgggcctggtcactttgtgctcctag
AGCAGATGGGCCGCATCCTGCAGCGCACAGCCATCTCCACCAACATCAAGGAGCGTCTGG
ACTTCTCCTGTGCCCTCTTTGGGCCCGATGGGGGGCTGGTGTCCAATGCCCCCCACATCC
CTGTGCACCTGGGTGCCATGCAGGAGACGGTGCAGTTCCAG
gtggcccttcccccgcctcacccttccatccccctccctcaccctccaccccccccccac
cccgctctggcccctgctcccctgtgcccactctgcacccatctcctggtttcagattca
gcacctgggggccgatctccaccctggcgacgtgctactgagcaaccatcccagtgccgg
EXON 18  102 bp
tggtgtccaatgccccccacatccctgtgcacctgggtgccatgcaggagacggtgcagt
tccaggtggcccttcccccgcctcacccttccatccccctccctcaccctccaccccccc
cccaccccgctctggcccctgctcccctgtgcccactctgcacccatctcctggtttcag
ATTCAGCACCTGGGGGCCGATCTCCACCCTGGCGACGTGCTACTGAGCAACCATCCCAGT
GCCGGGGGCAGCCACCTGCCAGACCTGACTGTTATCACACCG
gtgaggggtgctgcccgcctgcctctgctggggcagtggtggccgatgcagctgaccgtg
gctctccacccgctaggtgttttggccgggtcagacgcggcctgtgttctatgtggccag
ccgagggcaccacgcagacatcgggggcatcacaccaggctccatgcccccccactccac
EXON 19  175 bp
agattcagcacctgggggccgatctccaccctggcgacgtgctactgagcaaccatccca
gtgccgggggcagccacctgccagacctgactgttatcacaccggtgaggggtgctgccc
gcctgcctctgctggggcagtggtggccgatgcagctgaccgtggctctccacccgctag
GTGTTTTGGCCGGGTCAGACGCGGCCTGTGTTCTATGTGGCCAGCCGAGGGCACCACGCA
GACATCGGGGGCATCACACCAGGCTCCATGCCCCCCCACTCCACCATGCTGCAACAGGAG
GGTGCCGTCTTTCTGTCCTTCAAACTTGTCCAGGGGGGCGTCTTCCAGGAGGAGG
gtgagtgggagtggggtggggcaggccttctgtaggctgggacacatggccactgctggc
aagcaggcctggctggaccgtgggatgcagcccataggcccaggcctgccttgaggctgg
gaggagataggtggttaccccaaagggcagctgcagatcggatcccgggagctgagatga
EXON 20  185 bp
ctgcctcagaggggaccctgagccaggctcaaggagaggggctttcctgaggtgctgagc
agtcccaggccaggcctcggtgctttctaggggccagagaccttgtctggatctgggaaa
cctgggttgggggtgcagacagggttggccaggggctcagtgatgacactgtccatccag
CGGTGACGGAGGCCCTGCGGGCGCCAGGCAAGGTCCCCAACTGCAGCGGAACCAGAAACC
TGCACGACAACCTGTCGGACCTCCGTGCCCAGGTGGCAGCCAACCAGAAGGGCATCCAGC
TGGTGGGGGAGCTCATTGGGCAGTACGGCCTGGACGTGGTGCAGGCCTACATGGGCCATA
TTCAG
gtgggcctgggcacaggagtgtgggcggcagggccatcctgcaggtgacctggccaccac
tgatcctgctccctgccaggcaaacgctgagctggccgtgcgagacatgttgcgtgcctt
tggaacctcccggcaggcccggggcctgcccctggaggtgtcctcggaagaccacatgga
EXON 21  147 bp
gtgcccaggtggcagccaaccagaagggcatccagctggtgggggagctcattgggcagt
acggcctggacgtggtgcaggcctacatgggccatattcaggtgggcctgggcacaggag
tgtgggcggcagggccatcctgcaggtgacctggccaccactgatcctgctccctgccag
GCAAACGCTGAGCTGGCCGTGCGAGACATGTTGCGTGCCTTTGGAACCTCCCGGCAGGCC
CGGGGCCTGCCCCTGGAGGTGTCCTCGGAAGACCACATGGACGACGGTTCCCCCATCCGC
CTCCGTGTGCAGATCAGCCTGAGTCAG
gtgggccgtggggagagtgcctctaggcggcaggggcacggtgcggccgctgacagcctc
tcccttccctcggggcgcgcagggcagcgccgtgtttgacttcagcggcactgggccgga
ggtgtttggtaatctcaacgcaccgcgggccgtaaccctgtccgccctcatctactgcct
EXON 22  135 bp
cccggcaggcccggggcctgcccctggaggtgtcctcggaagaccacatggacgacggtt
cccccatccgcctccgtgtgcagatcagcctgagtcaggtgggccgtggggagagtgcct
ctaggcggcaggggcacggtgcggccgctgacagcctctcccttccctcggggcgcgcag
GGCAGCGCCGTGTTTGACTTCAGCGGCACTGGGCCGGAGGTGTTTGGTAATCTCAACGCA
CCGCGGGCCGTAACCCTGTCCGCCCTCATCTACTGCCTGCGCTGTCTGGTGGGCCGCGAC
ATCCCACTCAACCAG
gttcgcaggggtgtgtgcgcgagggggggccccagcccgaggtcaccctgagtgcgcctc
ctgggcccagccacggtctgaccccacgggtgctggggcggggggtggggtgctgtttct
cccggagcccaccccaagagctcctgagagccgcccgccccgcacagggctgcctggcgc
EXON 23  150 bp
cccactcaaccaggttcgcaggggtgtgtgcgcgagggggggccccagcccgaggtcacc
ctgagtgcgcctcctgggcccagccacggtctgaccccacgggtgctggggcggggggtg
gggtgctgtttctcccggagcccaccccaagagctcctgagagccgcccgccccgcacag
GGCTGCCTGGCGCCAGTGCGCGTGGTCATTCCCCGAGGCTCCATCCTGGACCCGTCGCCC
GAGGCGGCGGTGGTGGGCGGCAACGTGCTCACGTCGCAGCGCGTGGTGGATGTCATCCTG
GGGGCCTTTGGGGCCTGCGCCGCCTCCCAG
gtgcgggggcggggtgggcgcagctcgggggcggactgggtgggcaggctggagtaggag
cgggagggcgaggtggggacgccctgccccagcccagcgcagcgaccaggtgccctcacc
agggctgcatgaacaacgtgaccctgggcaacgcccacatgggctactacgagacggtgg
EXON 24  158 bp
gtcgcagcgcgtggtggatgtcatcctgggggcctttggggcctgcgccgcctcccaggt
gcgggggcggggtgggcgcagctcgggggcggactgggtgggcaggctggagtaggagcg
ggagggcgaggtggggacgccctgccccagcccagcgcagcgaccaggtgccctcaccag
GGCTGCATGAACAACGTGACCCTGGGCAACGCCCACATGGGCTACTACGAGACGGTGGCG
GGCGGCGCGGGCGCGGGTCCCAGCTGGCACGGGCGCAGCGGTGTGCACAGCCACATGACC
AACACACGCATCACCGACCCTGAGATCCTGGAGAGCCG
gtgagcggcgtgcgcggaggctgggggcacggccgggtgggagccggggctcgggccacg
ctgagtctttgccctcgtcctcgccctcgcaggtacccggtcatcctgcgccgcttcgag
ctgcggcggggggctcggggggcagaggccgcttccgaggcggcgacggcgtcacccgcg
EXON 25  110 bp
acacgcatcaccgaccctgagatcctggagagccggtgagcggcgtgcgcggaggctggg
ggcacggccgggtgggagccggggctcgggccacgctgagtctttgccctcgtcctcgcc
ctcgcaggtacccggtcatcctgcgccgcttcgagctgcggcggggggctcggggggcag
AGGCCGCTTCCGAGGCGGCGACGGCGTCACCCGCGAGCTGCTCTTTCGTGAGGAGGCGCT
GCTGTCAGTGCTGACCGAGCGCCGCGCCTTCCGGCCATACGGGCTCCACG
gtgcgcggttccccagccctcgcggccctccccgcccccgcccccacccccgcccctggt
ctctctggactcctcgcctccctccgcagggggcgagcctggcgcccgcggcctaaacct
gctgatccgcaaaaacggccggacggtgaatctgggcggcaagacgtcggtgaccgtgta
EXON 26  98 bp
gacggcgtcacccgcgagctgctctttcgtgaggaggcgctgctgtcagtgctgaccgag
cgccgcgccttccggccatacgggctccacggtgcgcggttccccagccctcgcggccct
ccccgcccccgcccccacccccgcccctggtctctctggactcctcgcctccctccgcag
GGGGCGAGCCTGGCGCCCGCGGCCTAAACCTGCTGATCCGCAAAAACGGCCGGACGGTGA
ATCTGGGCGGCAAGACGTCGGTGACCGTGTACCCCGGG
gtaagggccgcggcctgtcctgtccccctcccctcccctcccctcccggccccatcccac
agagggggaacagttgcagacctgaccagaggccgagtttaatttggccccggaaggaaa
gggggcgcgtaccgggcctccgtggtccatgggggcgggtgatggacgctgcccggtggg
EXON 27  147 bp
cagacctgaccagaggccgagtttaatttggccccggaaggaaagggggcgcgtaccggg
cctccgtggtccatgggggcgggtgatggacgctgcccggtggggaggggactgcgcagg
tgacagggaggggccacgcctgcactgagcccgcctccccgcccccccccgcgccaacag
GATGTGTTCTGTCTCCACACGCCCGGCGGCGGTGGCTATGGGGACCCGGAGGACCCCGCC
CCACCGCCGGGGTCGCCCCCGCAAGCACTGGCCTTTCCCGAGCACGGCAGCGTCTATGAG
TATCGCCGGGCCCAGGAGGCCGTGTGA
ggatcccgcaataaagatgccttaagtctcccggttctggggacgcagctacggcgccta
gttcgtgctccgagtcgtgtctgtgcgcgccagccgcgcgcccctcatctgtgcttgcct
taggaggacactgagactcggagctgcaggcgcactgcccggtggtccgtgagcccctcc