Gene NPM2 Variant 1
DNA : 12.76 KbNT_023666
mRNA : 1874 bp NM_182795
CDS : 645 bp NP_877724
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  490 bp
gattctgacctctccgtggcaatgagcccctgtcccaggggtgtgcgggagatccctggt
tatctgaggtgtctccagggtatatccgctgaaaccccacttcctcttcactgcccactg
agcctgggaccagctgctggtcacgtgcttggccctgtagcgtcgctagccgtgctcctc
AGTGTGCTCCCCGCCCCCTGCCGCGGCGCCTCGCCTCCCGGCTCACCTCCCCACCCCACC
TGCCCGCTGCGGCTCTCCGCGGGAGATCTCACCGTTCTGGAGACAGGGCTCGCTCGCTCT
CACGGTAGGCTGGAAGAACGGGCTGTCTGGGCCTTAGGAAAGGCCCATGCTGTATAAGGC
ATGGGGAAAGGAAAGGAAGAAAGGCAACGAACAAGAAGGAGGGCTTCCAACTGCAGCTTC
CTGCCGGCTGCAGGCCTCCCTTCCTAAGCTGAGCTGAGGCTTCCTCTCCATGGGCTGGGG
AGGGGGCGCCAGGAGGCCTCGGCGGGTCCGCAATTGGCCGGGACAGCTTCTCACGAAAGG
TCCTGGGCCGGCATCATCAGCCTCACCTGGGAACTGGTTAGAACTACAAATTCCCTCGGC
CCCACCCAGACCGACGCCAAGGGCAGCTGTGGAGTGGGGCGCGGCAATGCGCCCCTTAAC
AGCCCTCCAG
gtgattctgccgcgcagaggaggaaagaatgggagaagggaaggggagagggaggcggct
tctttgcgactaattggacacctgcccttccccttcccaggcttcttagcccgggcttgg
acagccgccttccggccagaggggatgaggttgcgctgcgctccgggagcgccgatggcg
EXON 2  583 bp
ttccctcggccccacccagaccgacgccaagggcagctgtggagtggggcgcggcaatgc
gccccttaacagccctccaggtgattctgccgcgcagaggaggaaagaatgggagaaggg
aaggggagagggaggcggcttctttgcgactaattggacacctgcccttccccttcccag
GCTTCTTAGCCCGGGCTTGGACAGCCGCCTTCCGGCCAGAGGGGATGAGGTTGCGCTGCG
CTCCGGGAGCGCCGATGGCGTGACTGGCCCCGCGCGGAGCAGCGACAGTAAGGCTGTGTG
GGGGGAGCTGGGACCTAAGCCGCGCGCACACCCCTTTCTCTGCGTCTGGTGGAGGTGCAC
AGAGGCTTTTGAGTCAGGCCCAAGCGCAGCCAGGTGACCTCCCCGCGGCCTTTCAAGCCT
GAGCTCGGTGGACAGCTCCCTCTCCCGTGAGTCCCGCTGTCCTGTACGCGCCCGGTCGAG
CCCCGGGCTGCGCACCCCGCTAGGAGGTGGGTACTCGTCCTCCAGGAGTTGCCGGTGAGC
CCTTGACCGTGGCAGGTCCCCTCCAGCCGCGAGCGACCCCTCAGTACCTGCCGATGCCTG
CTGGTCTCTGGCATCCTCCAGTCGAGGGTCAGGGTCAGGGAGCAAGGCCTCACGCGGGCG
CCCTCCTTGCAGCTGCCCGGCCAGCCCGCTTCTCTGCCCGGAGCCATGAATCTCAGTAGC
GCCAGTAGCACGGAGGAAAAGGCAGTGACGACCGTGCTCTGGG
gtgagtggggactcaggctccttcccagagacacgccccacctccggtgcgcggcagctt
ggggcgcaggtgagcccctcctttgggaacgaatggagggccccacttccctccctttct
cctccgcaggctgcgagctcagtcaggagaggcggacttggaccttcagaccccagctgg
EXON 3  86 bp
tcagtagcgccagtagcacggaggaaaaggcagtgacgaccgtgctctggggtgagtggg
gactcaggctccttcccagagacacgccccacctccggtgcgcggcagcttggggcgcag
gtgagcccctcctttgggaacgaatggagggccccacttccctccctttctcctccgcag
GCTGCGAGCTCAGTCAGGAGAGGCGGACTTGGACCTTCAGACCCCAGCTGGAGGGGAAGC
AGAGCTGCAGGCTGTTGCTTCATACG
gtaggtgttcccaaaagaggggaggaagatggtgtccgggaactttctggtcccaacgga
gggctatggatttctcccgtcggccctcagggtgatgaggggcctctattttcaaccccg
ctcagatttgcttgggggagaaagccaaagaggagatgcatcgcgtggagatcctgcccc
EXON 4  126 bp
gaccttcagaccccagctggaggggaagcagagctgcaggctgttgcttcatacggtagg
tgttcccaaaagaggggaggaagatggtgtccgggaactttctggtcccaacggagggct
atggatttctcccgtcggccctcagggtgatgaggggcctctattttcaaccccgctcag
ATTTGCTTGGGGGAGAAAGCCAAAGAGGAGATGCATCGCGTGGAGATCCTGCCCCCAGCA
AACCAGGAGGACAAGAAGATGCAGCCGGTCACCATTGCCTCACTCCAGGCCTCAGTCCTC
CCCATG
gtgcgcatttccctgctggctggaagactgctgtcagcctcaccctcacccttgggtggg
gatggacacacacgagggtgcattcaccctacagaaatgagccatgctagggaggtagca
cagcccatgcagaaagccggggtccagcccagctcaccccttcctagagctgtgtgacct
EXON 5  94 bp
gtgagcttagcaagaatgggattaccaggttcaaattcttggacagaatccacctcagca
ggggctgagtagtgtgtagggtttggggagggaaatcaactcagtatttctgcctgaggc
tagtccccgagaggtgccaggcctaagtggccctgtcttctctgcttcctccccctgcag
GTCTCCATGGTAGGAGTGCAGCTTTCTCCCCCAGTTACTTTCCAGCTCCGGGCTGGCTCA
GGACCCGTGTTCCTCAGTGGCCAGGAACGTTATG
gtaagtcagagcctgcgatcaggaaggtccgtgagtaccgtgctaggcaggggctcggga
catactagctactcaaacactggagggattcttgaatgttggaagaaaatccccaaaggc
aacatgacagccagcagcctggactggaaggcaagggcgctggtccctgttcttcttctt
EXON 6  167 bp
gttgggagggccagaaagggtgccgccctgtacaggtggcaggcaggtaaccactgtcaa
ctccaggctaggattcctccagggcagtgcttggagcaacacggatcacagaatgggagg
tgggcattgattctgtagctctgaagctgtgcccctgcatcctttcccatgctattacag
AAGCATCAGACCTAACCTGGGAGGAGGAGGAGGAAGAAGAAGGGGAGGAGGAGGAAGAGG
AAGAGGAAGATGATGAGGATGAGGATGCAGATATATCTCTGGAGGAGCAAAGCCCTGTCA
AACAAGTCAAAAGGCTGGTGCCCCAGAAGCAGGCGAGCGTGGCTAAG
gtgggggaaggagcgtggctgtttggaaggaagtggtacccctacagaagcacttaagag
gggtgggccaccgggagcctgggccagcctcccagaatgagtgtacaggatgggccaagg
ccacctcagctagttctggccaggagctcagcggggaccttgtggactttgggaatctgt
EXON 7  35 bp
taagaggggtgggccaccgggagcctgggccagcctcccagaatgagtgtacaggatggg
ccaaggccacctcagctagttctggccaggagctcagcggggaccttgtggactttggga
atctgttctggctctggactttgtctgaactctcataatacactgttttttggttcccag
AAAAAAAAGCTGGAAAAAGAAGAAGAGGAAATAAG
gtaactctttctacctattaaattagccaaagtctccagctgagatatacagtgttagaa
agaatactgtgctgttgggatgtacgtgtacaaatgtacacacggtgtgtctacctgcac
tcgcaggcacatgggtatggaagtgctgaagggtggcatcacctttctggaagagcatta
EXON 8  34 bp
catatgcgtatgcatgcacacgcacacacatccctttgtttaaagagtccgagtggtccc
caggaggagcagccaggcttgctttccagggtgggcactgggagggccacgccgctggtc
tggagctgagctctctccctgaccccaatcccactcctgctccgctccaccctgttgcag
AGCCAGCGTTAGAGACAAGAGCCCTGTGAAAAAG
gtgagtaggaccagagggctttggcccttgggacaggcgagtattctctggagggggctg
cctggtatggagaagggaacgggaccctggagccctgccttccctccacaggccaaagcc
acagccagagccaagaagccaggattcaagaaatgaggagccacgccttggggggcacgg
EXON 9  259 bp
caatcccactcctgctccgctccaccctgttgcagagccagcgttagagacaagagccct
gtgaaaaaggtgagtaggaccagagggctttggcccttgggacaggcgagtattctctgg
agggggctgcctggtatggagaagggaacgggaccctggagccctgccttccctccacag
GCCAAAGCCACAGCCAGAGCCAAGAAGCCAGGATTCAAGAAATGAGGAGCCACGCCTTGG
GGGGCACGGTGCAAAGTGGGCCTTCCCTGGGCTGTGCTGCAGGCACAGGGTGCCCCTGTC
CAGCCCCTCCACCTGTGTCTGAATGCAACAGGGGTGTTGCGGGGGCAACATGAGAGCCCC
TCACCCCCAACTCTCCACTTTCAGGAGGCCCCCAGTGAAGAGCCCCACCTCGGGGTCACA
ATAAAGTTGCCTGGTCAGG
actttccttctcttccctggagccagcctccttgtccgctgcaccagccccagtgcccgg
cagagggcagccttgaaccggtgcacccgggccctgaggtcatacctgcctccctgcacc
cagcccccgcggcctgagcctgctgtgtccctcgtcctcggcacccccaattctccccca