Gene NAT2 Variant 1
DNA : 9.93 KbNT_030737
mRNA : 1276 bp NM_000015
CDS : 873 bp NP_000006
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  101 bp
cagctctcctagcctgtggcatgggtatcatcagataatataattatccacaccattttt
aacaaaaagatttgcgtaagagattcacagaggcaacctgaggccctgcaactacatttc
ccagagatccctgaggtgatcctaactagactctggtgtcagggtgatacggaattccag
TGAGATCACTTCCCTTGCAGACTTTGGAAGGGAGAGCACTTTATTACAGACCTTGGAAGC
AAGAGGATTGCATTCAGCCTAGTTCCTGGTTGCTGGCCAAA
gtaagtagaactttgtaagtaatttgcagtgtactttgaaagtggggtataaattaaaaa
taaaatcaagtccccctactgactgaatggatcccctcttgtcctaggcgaccccagaga
aacctggaaaactaaattccaggccataatggaaagggaggtcagacacgcctcattata
EXON 2  1175 bp
gaacttatgcatgtaaaagggattcatgcagtagaaatactaacaaaagaattactatga
cagatacttataaccattgtgtttttacgtatttaaaatacgttatacctataattagtc
acacgaggaaatcaaatgctaaagtatgatatgtttttatgttttgtttttcttgcttag
GGGATCATGGACATTGAAGCATATTTTGAAAGAATTGGCTATAAGAACTCTAGGAACAAA
TTGGACTTGGAAACATTAACTGACATTCTTGAGCACCAGATCCGGGCTGTTCCCTTTGAG
AACCTTAACATGCATTGTGGGCAAGCCATGGAGTTGGGCTTAGAGGCTATTTTTGATCAC
ATTGTAAGAAGAAACCGGGGTGGGTGGTGTCTCCAGGTCAATCAACTTCTGTACTGGGCT
CTGACCACAATCGGTTTTCAGACCACAATGTTAGGAGGGTATTTTTACATCCCTCCAGTT
AACAAATACAGCACTGGCATGGTTCACCTTCTCCTGCAGGTGACCATTGACGGCAGGAAT
TACATTGTCGATGCTGGGTCTGGAAGCTCCTCCCAGATGTGGCAGCCTCTAGAATTAATT
TCTGGGAAGGATCAGCCTCAGGTGCCTTGCATTTTCTGCTTGACAGAAGAGAGAGGAATC
TGGTACCTGGACCAAATCAGGAGAGAGCAGTATATTACAAACAAAGAATTTCTTAATTCT
CATCTCCTGCCAAAGAAGAAACACCAAAAAATATACTTATTTACGCTTGAACCTCGAACA
ATTGAAGATTTTGAGTCTATGAATACATACCTGCAGACGTCTCCAACATCTTCATTTATA
ACCACATCATTTTGTTCCTTGCAGACCCCAGAAGGGGTTTACTGTTTGGTGGGCTTCATC
CTCACCTATAGAAAATTCAATTATAAAGACAATACAGATCTGGTCGAGTTTAAAACTCTC
ACTGAGGAAGAGGTTGAAGAAGTGCTGAGAAATATATTTAAGATTTCCTTGGGGAGAAAT
CTCGTGCCCAAACCTGGTGATGGATCCCTTACTATTTAGAATAAGGAACAAAATAAACCC
TTGTGTATGTATCACCCAACTCACTAATTATCAACTTATGTGCTATCAGATATCCTCTCT
ACCCTCACGTTATTTTGAAGAAAATCCTAAACATCAAATACTTTCATCCATAAAAATGTC
AGCATTTATTAAAAAACAATAACTTTTTAAAGAAACATAAGGACACATTTTCAAATTAAT
AAAAATAAAGGCATTTTAAGGATGGCCTGTGATTATCTTGGGAAGCAGAGTGATTCATGC
TAGAAAACATTTAATATTGATTTATTGTTGAATTC
atagtaaatttttactggtaaatgaataaagaatattgtggaaaaactcactgtctctaa
agtttatgaaaacattgttggctaatatattgtgaatcaaagtttttctttagacgactt
aggatattatggggctaggcattttttcctcaatagagtcttcctctcatcctctttctt