Gene MTMR9 Variant 1
DNA : 43.33 KbNT_077531
mRNA : 7081 bp NM_015458
CDS : 1650 bp NP_056273
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  264 bp
cgagtcctaggcctggtgaaccgcgcggtgcgggagaggcgcttgggcctcgtccagccc
cagcccctgtctccccgcggccggtgccggcggctgtaggcctcgccgcgcccacccagc
ctggggcgggcccagcctcaccgcccggcccgccccgccccacgggccagccccgcgccg
GGTGTTTCCGCTACTTCCCTGCGGCGGGGTAACCGCCTCGCACCTACCGGGCTCGGTTCC
CTGGCTCCGGCCGCGGGGGAGCATGGAGTTTGCGGAGCTGATTAAGACCCCGCGGGTGGA
CAATGTGGTGCTGCACCGGCCTTTCTACCCGGCTGTCGAGGGCACCCTGTGCCTGACGGG
CCACCACTTGATCCTGTCCTCCCGGCAGGACAATACGGAGGAGCTGTGGCTCCTCCATTC
AAACATCGACGCCATCGACAAGCG
gtgagtgcccgccccaccccagctccgcagggagccgggggtcccttgtgggcgccccgg
gaaatacttcctggcgttttccgcgcagcctgccgcccagctagccggcaagatgagccc
tctgtggcctagaatcaggatttaccaagctgaaacccgtccagatggaggacccggttt
EXON 2  109 bp
ttgtaagtaatgtatggctcacattttaatgatgcagccttgcttcttccttaattagac
tgaggagaagaaagttaatatagatggtaactacaactatattctcttttcaaagaaata
ataatatatttaaagttagtaatatatgtgttcctaaacatgatttgcaatttcttacag
ATTTGTAGGATCACTGGGTACCATCATCATAAAATGTAAAGATTTTCGAATTATTCAGTT
GGATATTCCTGGAATGGAGGAATGCTTGAATATAGCCAGTTCCATTGAG
gtaagtattttggaagcaaaatctaatgaaacataattttatattatgactcagtgtagc
tcttccatttcttcattagataatttagtcatgttctctgactcaaatactgaagactga
taggaaaagcctcaccctggttcatcgtcatatgagtgtaatggaactttcttgacttcc
EXON 3  126 bp
aagcaaagaaatcagcttcagtaagactaaaattgtatctggtgataaacacaatgttag
agaaacattctgggtgcccatcattattagaccatgtttgcttaatactaatttgtcagt
tagaatatgtttccagttgtggatgtttcttttttgtctttcttttctttttgcccccag
GCATTGTCTACTCTGGACTCCATCACTCTGATGTACCCTTTCTTTTACCGTCCTATGTTT
GAAGTGATAGAAGATGGCTGGCATTCCTTCCTTCCTGAGCAAGAATTTGAACTCTATTCT
TCAGCT
gtgagttaacttttgagaactgtggattatgagaagtaacccaataccttatttgacttg
tgaaaatgatcacttcttttgaagagtaataaggtgaagttgacttatccattcctaatc
ttaatatatttaaaaggattgaagccatgcagagtatgatctctgatcacaaaggaatta
EXON 4  174 bp
aaccatagagctccttttctctgcagctacttacatataagctagagatccacctgtgaa
attcctgagaaatggcttcttcatcagtgaaagttgacctctaaggtcttttaaaatttc
tcagattattttgcgacattgagatagttgcttagctttgaagtattttgtgtttttcag
ACCAGTGAATGGAGGCTAAGCTATGTCAATAAGGAATTTGCTGTCTGTCCCTCTTACCCA
CCAATTGTCACAGTGCCCAAATCCATCGATGATGAAGCTCTTCGGAAGGTAGCTACATTT
CGACATGGAGGGCGCTTCCCAGTACTAAGCTATTACCACAAAAAAAATGGGATG
gtaagtgcacagcactactgcttgatgtactgaaaggcttgggttggggatcttttcgta
gaaatgttcccttttgctctctgtctgttcactgaaatgattgtccaggtctccaccaca
agggcttccttcatgtaagctttagggaatcaggagtagggtgttttctgtggtgaggat
EXON 5  218 bp
tcttttatagttattaactattgtcaatacatgcaaatatttctttgtttatggatcaaa
tccatctgcagagtgtcacacaattgtttttgagatactcttaatctagctaatttcttt
ctgttttcagaaactttaaaagcaactgctgttgaattttcagctttattatgcttctag
GTAATTATGCGAAGTGGTCAGCCACTCACTGGTACAAACGGGAGGAGGTGCAAGGAGGAC
GAGAAGCTGATAAATGCTACCCTCAGGGCTGGAAAGCGTGGCTACATCATTGACACCCGA
TCCCTGAACGTGGCTCAGCAAACTAGAGCCAAAGGAGGTGGCTTTGAACAAGAAGCTCAT
TATCCTCAGTGGAGGCGAATTCATAAGTCCATTGAGAG
gtaaaagattccaaagatagtacagactcttattagaagctaattatagtgggtaaggcc
ttagccatttgaaaatcacaagtgctcaaattaacttctgcattaatttagggtcaatga
tgggctagccatcttctcatttttttttggtcagctctattaaggtttgattgacaaata
EXON 6  162 bp
caacaatgtttaaatattagtttttcaacctttaatcctcaaattatagcagggtaaata
tttttatagtattttgaactacttttgctcttagatatgttggaggctgaatctttggtt
tggtttctttatctttctattttctgggtttgttattttttactttcttacttttaaaag
GTATCACATTCTTCAGGAGAGCTTAATCAAACTTGTGGAAGCTTGTAATGACCAAACACA
TAACATGGACCGATGGCTCAGTAAATTGGAGGCCTCTAACTGGCTGACTCACATCAAAGA
GATTCTGACAACTGCCTGCCTAGCGGCTCAGTGCATCGACAG
gtaaagtgcatttcagcgttcctgagcgaaacatggcgctgctaactagactttgtgttt
atccagacatatgtttatagattatgtgaaagtttgcagtaaattactgtgtaggctagt
caacaccatcccattattgatgaggtgtgtgcctagagtctggcatttaatagataatgt
EXON 7  142 bp
cttagatttagatttagattctgaactctacaagtcagagcagaatgttgtactcaatac
actaaataaactgaactcagtagactaaaatgttgtgctcaataaacgcttgttattaac
agagttcattgaccatgttggacatttcccatttgtactcttccctgattttcctatcag
GGAAGGAGCATCAATATTGATTCACGGAACAGAAGGAACTGATTCCACACTCCAGGTGAC
CTCCTTGGCCCAGATCATCTTAGAGCCAAGAAGCAGGACCATTCGTGGTTTTGAGGCCCT
GATTGAAAGAGAGTGGCTGCAG
gtgagaagagctgtttgattcacagaggaactgcttattgatgctgtgatcctgctttgt
gtggtagctgacataatgtgtgaaatttcgattgattaaaatttctaagttgtgtgttta
atttactgcaggacagttaatctgtcttctccttgtttctggatgtctctttgcctgtat
EXON 8  221 bp
tagttgctgccgctatttattttataccaagaaatcattaatctgtacaacagctaccct
aattatatgatgttccaggtactaggagtgtcactgtaattgtgtatagtggtgtcggta
gaatgctctgtcatgtgatctcaccaggatatgactgtcacgcctccatcttccccctag
GCTGGTCACCCATTCCAGCAGCGCTGTGCACAGTCAGCCTACTGTAACACCAAGCAGAAG
TGGGAGGCTCCTGTATTTCTTCTCTTCTTGGACTGCGTGTGGCAGATCCTTCGTCAGTTT
CCCTGTTCTTTTGAGTTTAATGAGAATTTCCTCATCATGCTCTTTGAGCATGCTTATGCC
TCACAGTTTGGAACATTTCTGGGCAACAATGAAAGTGAAAG
gtgagtacactgctcacatggggacctttccttttccgttgttttggctacttcctaagt
agccagaatctcctaggagacgacgatttggatctatattaaaattatttataaaaaggt
agaggctacagttaattataatttaaatgacctgaagtatattcttttatgagagcatgt
EXON 9  152 bp
gttctaatgccgattgagctttttgacaaatctattgatttttcaacactttgtttctct
accaaaagtcttgtattctatcttctttcatactgagaagaaattgtcctcgtaagagga
gcactcaataatggttgttataaattaattactttaatggcagtgttctttcttgatcag
ATGTAAGTTGAAGCTACAGCAGAAGACGATGTCTTTGTGGTCCTGGGTTAATCAGCCCAG
TGAGCTGAGTAAATTCACCAATCCCCTCTTTGAAGCCAACAACCTTGTCATCTGGCCTTC
AGTTGCTCCGCAGAGTCTTCCACTGTGGGAAG
gtaaaccacgcatcctttgcaaacttcttaacggtcaggtgtgcatgcggctgcctgtga
gtgtgtgctgttggtgatgtatgaagatggtgagctggacgtggccctcagacctgtgtg
aattgtcattctcagtgtgggcatgtttttctctttcaaatcagttatctagccacactt
EXON 10  5513 bp
atccttttcagtacctcaagattcctgtatattttagagtataataaaatacagatgtga
gttgtggcaacaaaagaaaaaagaatgtataatacataaattacatcttatccacaaatg
taattttaatccattgtatatacctttcttgcttctgttttccattcctggattcaatag
GTATTTTCCTACGTTGGAATAGATCCTCTAAGTATTTGGATGAAGCATATGAAGAAATGG
TTAACATCATTGAATATAATAAAGAATTACAAGCAAAAGTCAATATCCTTCGAAGGCAGT
TGGCAGAACTGGAAACAGAGGACGGGATGCAGGAGAGTCCCTGAAAGGTCTCCTCGCACC
CTTCGCAAGGACCTTCTTGGGCCTGTGTCCGCCGTTCTCTCCTTGTGCCCTTCAGTTCAC
TTTTACACGGTAGCCTTGAAGTGAAGGCTTTAGATGTGGGACCCCCCTAATGTAATGGAT
TTCTCAATACTGTATGAATAATGAAACTTACTATCATAAACCATGTTTCATGTGGCCTGT
TAGGGCCTGTCACTTTGGGAGCCGGAAGGAGGTGCTAGTCATTTTATTTTTACGTGAAAT
AGATGACCTATTTAATGCCATTTGTGTTTCATGCCATTTTATCCAAAGCTTTTTCTCTGT
GTCCACTCTCCAAACAGCATTCTAGAGCAGTCAAGGAGACAGCTAATCTCTCTAGGGACT
ATTTGGTGGTTTAAAAAAAGGGTCAGACTTTTAAACACTCTGACCATAGAAATGTTTTTC
AAAATGGCAACAATGGATAAACCAAGGATTTTGTGTTTAACAATCCATTTCCAGTGTCTT
CGCCACATAAAATAGCCATTTTCTTTAAAATAGTTTTGGACTAACGAAGCTGAAATCTAT
TCTCATTCTTGTTTGTCAAGAAAGGAAAATCTGTTATTCAAGGTAAATTATTTCTACAAG
GGCAACAGGTATGGTCCTCCGATATTTACATTAAGAAGAGTTAAATTTATTTTAACGTAG
ACACTAAAAGTATGTGCAATATACAATTAAAGTAGGAATTTGTTACTGATTGAGAATTGT
TACTGGTGAATTGGTTTTCAGGTTTTGAGCATACATATACAATGTGTTTCAAATGCTGCT
TGTAAAATTAAACCATCATCTAGAATAGAGTTAATTTATTATAATCAAGCTACAAATAGG
TTTTCTTAAACCAGAGATGCACTGCCCTTGTCTAAAGTTCTTATTGCACTGGTTTATATG
TGTATGTGTGTTTTATTGTGTGTTTTTTTAATTTGTAAGTATTCTAAGAGTTTCCTAATA
CTAAGGTTAAAATTTTCATGTTGACCTGAGCCTTTTGCAAATTTGCTTTGGCTCTATTGA
TTTGTCCATTATGTGTTAGGCAAATATAACTTAAGTGGAGGGGGAAGTTTATGAATATAA
TATAGCTCTGTGTTTTAAACCTCAGAAACAGATTTGAGTGTTTCAGTATTATAGAAACAG
TGATGACTATTCATGCTCTGCTAGTCTATGCCTGCAACTCCAAATGTTTGTGGTTCAGTA
TTTCCCACCTACATTTCTGTTTGGTGACATTGCTCATTTTAACAAATATGACCGAGTCTA
GTTTTTCTTTAAAAGGATAGTTTATGAGTAATCTTTAAAACCATTTCCATACCATCTGTA
TATAACCATTTCGGTAGAGAACACACTACACTGAACCCTGCTTTAGAGCTGTGTGTTGAG
CTAAAAATATAATTTTTTAAAAATTGACTAGCAAAATCTATGGCCACACTGAGAAGCCTT
TGAAAATGGCAAATACTTTTCATCACCAATTGCCCAATTCATCTTTCTTCTGCTTCCTCA
GCCTTGTAGCAAAGGCTACACAGCAGCCCACAGTCCACAGTCTTTTTGGGAAAATTGGCC
TGCCACCTTCTTTAAGCTCAGTTTATTTTTGACTTACTTTCTTTGCTGTAGTTATGAACC
TTGGGGCATTAAAATCCCATGGCAAGGAGCATAAGAGATGTTCTCGTAGCTCTGCGTTGT
GTGAAATGTCCATCTTAGTTTTGTTAAAAAAAAAAAAAAAAAAAGGAAACAGCCTCACTT
TTTTGTGCTCCCTCAGAATTGCTTGCTATGTCTGTTAATACAGCTGAGCTTTTTGTTTTC
TTCTCTTTTTGTCTCAAGATTGTATATGAAGGAGGCTTTTCTTCTCAGCTAACAGGCATA
TAAGGAAAACCATCTAGAGAGTTTTCTTTAGAAGTGACTCCCATTAGCCTGGTGTGGTGG
TGTGTGCCTATAGTCCCAGCCACTAGGAAAGCTGAGGCAGAAGGATCCCTTGAGCCTAGG
AGGTTGAGGCTGCAGTGAGCTATGATCGCATCAGTCCACTCCAGCCTGAGCAACAGAGCG
AGACCCTGTGTCTAAGTAAAGAAAAAGCCAGAAGTGACTCCCACTGCTTCTGTTGATCGG
CCATAGGGCTTCCATGGGTGGAAACTTGTGAGGGAGTTTGTATTAGGTCTGGTCATGGAG
GGATGATGTACCATCAAGGTAGACCCATCTTCCTGATGCACATTTGCTGTGCGAGCCAGA
GTACAGTCATAACACGGTATTCGCATTTCGTTTTCTCTGTCTCACTGAGACAACAATCTA
TACTGTTTTGGCAAGTTTGCATTTTAGTATTAATTTATAATTAGGGATTGTTCAAACTTC
AGATCTGTTTACAGGTTGTAAAAATAAACTTCGGTATCAGTGCATCTACAGAAGTGTTAT
TTGGTAATCCAAATATTAGAGTTTTCCCAAATCCAAAAACGGTCAGAAATAAGTCCATTA
TCAATATAATTTGAAGAAGATTTTTAGTAGTACTGTGAAGTTCGTGCTTACCTGGATGAG
AAGAATAAATGACACGGATACACTCCTGAGAAGACACTCGTTAAACATTGCATCGGAGAG
CTGCCTTTGATAAATGTGCTGTTAAACACTTGAATGAAGAGAATGGTGGCAGAATGAGTG
AGCAAGCAGATTGCCCCAGAGGGGCCGGTAATAATCACGTGAGGGATAATCAGATTCCTG
CGTATTCAGCATCTTCTCTATTCATGTGGAGTGAAAGCTGGTTTTTATACAGGAGATACG
TAAAGTAGGCCCCACAAATAATATTTTTAAAATACAAAGGATCACCACAATCCTCTATTG
AACATATAAGGATCCTCAGATTTAAATAAGTACTTTTTTTTTTTTTAATCAGAAGAACAT
TGTTGTTTGATTATATGTTTTTAAAAACCTGAAGCTTTTTTGGTGGCAGGACCTTTCAAT
AAATATTTATTTGGTCAAAATTTTTTATTTTGATTTTATTAAATGGGAAGAAAGCAAGCA
GAAATAGTAAAATTCAGTAGGTTTAAAACAATCTATAAATGTATTTTATTTCCAAGAAAA
CTTAGGGTCTCAAAGCAAGATTTTAAAGTGATTTTTGAGAAGACTTGGGGGGGACAATAA
TAGACATTCATGTCAGATCCCATATGGGGGATTTTTAAACATTTCTTTGAACTTTGAGGC
CTGATTTAGGGGTGGGATTTTATTGCTTTTTGTTTTAAAGGATGAAATTTTGTGGGGTTT
TAGTCTTTGATTCAGTCAGTATTTGGTTTATGTTAAATAAAAAATCAGTATCATGGAAAA
GATATGACCATAATTTAGTCTCCTCAAGTGAAAAACAGGAGTAATGTTTCGTTGCACTTT
GAAAGATCTGCTTCAAGGCATAACTCGTGTAGTTGTCTGGTTTCAGGGATAGCTGTTTGA
ATTGTCATTCTAAAGTAGGTCATCAGGTTCACTTATTATCCGACCTTAATCTGGGATAAA
GGTTTTGGTATTTGCCCACTTCTAGATAGAATGAATGAAAACAACACAAGCGTTTTATGA
GCACTCTTTATCAGAAAGGTATTTCCTGGACCAGAAATGGGCAATAGTTACAATAGTTGA
TCCTCTGTTCTGGAAGCTTTGAAATTTATCAGAGAATGAAGTCATTCAGTACATCTGATA
AAGTTTTGTTGTTGTTGTTGTTGTTGTTGTTTTAATTGGGCAACCCTCAGAACTGAAGAG
GTTCAGAGAACTTTCCAGGTTTATACTATACCTCAAGACCACATAGATTAGCTACTGCTT
ATTCTTTCACATGGGCTAGGCCTGTTCTCCTCCTCCAGACCTAGTATTCTAAGTTATTAC
CACATAGTATTTTTATGTTACCCATCATCTTTAAAAACATTATAGGCTGGGCATGGTGGC
TTACGCCTGTAATCCCAGCACTTTGGGAGGCCAAGGCGGGCGGATCATGAGGTCAGGAGA
TCGAGACCATCCTGGCTAACACGGTGAAAACCCATGTCTACTAAAAATACAAAAAATTAG
CCAGGTGTGGTGGCGGGCGCCTGTAGTCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATG
GTGTGAACCCGGGAGGCAGAGCTTGCAGTGAGCCGAGATCGCACCACTGCACTCCAGCCT
GGGCGAAAGGGCAAGACTCCATCTCAAAAAAAAAAAAAAAAAAAGACTCATTTATCCATT
TACATTTATTCTCAGATGATAAAATATATACTGATACTATAACTTTCTTATGGTATCAGT
TTTCTTTATTTTCTTGAATAAAATTACTTCTACCTTCATTTGGTCTTTATAATCCACTGT
CCACAGCATCTTCCTTTAAACCAATAGTCCCAGAAGAGACCCTCTGAAATTCTAGGACTG
GATATTAAAATGCCTGAACCTGTTATCTAAATCCTTTTTAAGAAACTTAATGTTCCAGCT
CTTGAACTACACTGTGGAACAGTAATTTGTGCCCAATTTAGTGGAAGATAATGAGGCTCA
CTGTAAACACTACATTGTCCTGCAAAGTAATTCTGATGAGAGTTTACTGACTTCTAGAGC
CATTCTCTTTAACCGTCTGCAGGTCTAAGGATTAACTATATTTGTGATTTGTAATAAAAC
TGAGTTGTACAACACTGCCTGTGTTTGTCTGGCCAAGACATTTGCTTCACTTTTAAAATG
CACGTTATCTTTGGAGAGGTGAATTATTCTACAAAATGCACCCTAAATCTCATTGTTTAA
AACCTTACTGATCTAATACCATCTACACAAAAAAATGTTGTAGTTGCAGAACTTAGTTTA
TAAAAACAAAGAATGTGTATTTCTTCAATAGCCGGGTATTTGGATTGTTCTCTTGATAAT
ATTTGAATGTGACTCTTGGATTTAAGTGCACTATTATTCATGGCTTATACAATAAAATTG
CACTGTATGGCAAATATGTCTATAATGTATGCTTTGCTGAAACCTCAAGAGTGCTGTAAG
GTACAGGTTTCCATATTGTGAACCTGTGTACGCACACACACATATACATACAGTCTTAGG
GAAAAAAAAAAGCAGAACTTTTGTAAGTCTGTGTAACATTTTAATATTGTTTGTAATATT
CACTAGGTGATAATTTCCCCTGTACCCTATAACTGTAATCATTCACCTTGGGTTGGCCGG
TTTGTCAAGCTTGGTTTACTGAATCAAGAAAGAGTCTTGTCGAATGTGGTACTGTTCTTA
GTGTGTAATATTTGCGTATGGTGTTCCTCTGCCTCAGAGGACAGTTGCACAGATGGCTAG
TGTTAAATTTCTATAGACGATGGTAATAAAATCTGAATATATTTAAGTGCTAA
taaattaaatctgtgggcttatttgaatttttttttcaaatattggtgaaggtttggatg
gtgtttcaattaaatctatatattttttaccttacattttgaaaaaattgagatctgcaa
aaaggctgcaaaatagtacactgatctccctagattgttcctatattgaatgattggtaa