Gene LY6H Variant 1
DNA : 2.37 KbNT_023684
mRNA : 904 bp NM_002347
CDS : 423 bp NP_002338
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  87 bp
aagggggcgcggagggcccgggccagctacctgcgtgggggccgcgagccccgggcgccc
cccgccccgcgcgtctcccagccgcccccgccccccgcgcggcccccgccccggctccgc
cccgcccctcgcgcggggtccgcgtctgcggctgcgttccccgaaagacgaggctgcgcc
CGGATTCCGGTCCGCAGGGAGACCGAAGGGCACAGCTCCCCGCGCCGCGCACGCCGCCCG
AGCCCGGAGTGCGGACACCCCCGGGAT
gtgagtgagccccccgaccccgaggcccgcgctccacgccccatccgcggtgagcgccga
ggcgcgcgcggaaggccaagggaggggactcggcccggggttcccggccccccagcccag
gggtgggggtggggacctggcacgcgcccctccccccagtggcaggtcccacccgctccc
EXON 2  128 bp
aggccagacgtctcccggcggggatgctgtgacggcggacgctctggagaaggggctggg
ggtggggctctgcgagctccgggcggaccccggccttggattccggggagaaggttgcat
cctgaggctgggaaaggagagggtctttggggtctcctgaccgatgcttctcccctccag
GCTTGCGCCCCAGAGGACCCGCGCCCCAAGCCCCCGCGCCGCCCCCAGGCCCACCCGGAG
CATGCTGCCTGCAGCCATGAAGGGCCTCGGCCTGGCGCTGCTGGCCGTCCTGCTGTGCTC
GGCGCCCG
gtgagtagggggcccgcgggctgggtcaggtgcctgggagagcccgaggcgccgcgggag
agccgggtgtggggctgccaccctctgacggttcccaccgcacttcgcatagagcccacg
ccccctccgggacccctgcgaccccagcccggccctcggcccctctgccccggcactggg
EXON 3  120 bp
tggggcacagttgtcccagggcctctgctccccctccaggggtcatgggggcctgctccc
tcccgtggggtcgggctctcccaggagtgcctgcagcagggggatgggtggggggcgcag
ggggctgcctggtttggaccccagtgcctctggtcaccctcctccccatgccctgcccag
CTCATGGCCTGTGGTGCCAGGACTGCACCCTGACCACCAACTCCAGCCATTGCACCCCAA
AGCAGTGCCAGCCGTCCGACACGGTGTGTGCCAGTGTCCGAATCACCGATCCCAGCAGCA

gtaagttgggacttagggtggtggggaatgtgctaaaagccaggctcttgagagaggtca
gaggtgtcctcggagcccctctggcctgggacgagagtgagagcgtggggcggcaggcag
gatactgtcctgctgtccccccctggctccttggtggcccttttcatctagttgaggcca
EXON 4  569 bp
cccccctggctccttggtggcccttttcatctagttgaggccagcgtgggagggtggagg
gactcggccctgcctactggggccccgagctgacccggaggggcctgggctgggtcctcg
ggatgaggcagagagggcccaggaggagcccccgtcccaggccacgctttctcttcccag
GCAGGAAGGATCACTCGGTGAACAAGATGTGTGCCTCCTCCTGTGACTTCGTTAAGCGAC
ACTTTTTCTCAGACTATCTGATGGGGTTTATTAACTCTGGGATCTTAAAGGTCGACGTGG
ACTGCTGCGAGAAGGATTTGTGCAATGGGGCGGCAGGGGCAGGGCACAGCCCCTGGGCCC
TGGCCGGGGGGCTCCTGCTCAGCCTGGGGCCTGCCCTCCTCTGGGCTGGGCCCTGATGTC
TCCTCCTTCCCACGGGGCTTCTGAGCTTGCTCCCCTGAGCCTGTGGCTGCCCTCTCCCCA
GCCTGGCGTGGCTGGGGCTGGGGGCAGCCTTGGCCCAGCTCCGTGGCTGTGGCCTGTGGC
TCTCACTCCTCCCCCGACGTGAAGCCTCCCTGTCTCTCCGCCAGCTCTGAGTCCCAGGCA
GCTGGACATCTCCAGGAAACCAGGCCATCTGGGCAGGAGGCCTGGGGATGAGGGTGGGGG
GGGACCCCCAGGTCCCGGAGGGGAAGTGAAGCAACAGCCCAGCTGGAAGGGCGTCTTCTG
CGGAGAAATAAAGTCACTTTTGAGTCCTG
agacccgggtctgagcctgggtgtcgggggcgggaaagggttcctggcagagagctggga
atgaggtgctgagggagcggaggggctgggggcagggcgggcgctcagccaggatcttgg
gctcttgggctcagggcactggggtgctgggtggttgtgctggggctgcttggtcctggt