Gene LOXL2 Variant 1
DNA : 106.93 KbNT_023666
mRNA : 3432 bp NM_002318
CDS : 2325 bp NP_002309
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  164 bp
ggccttggcctcccccgcggagctccctctggccctgggagtggccgctctcgaattaca
acaaaagaggccggaggccgggcctgctgcggcggccgccttcggggaagggggtgggtc
cggggaggggtttgccatcctcctctagttaaaagtaagggggaaaagagtaaacgcgcg
ACTCCAGCGCGCGGCTACCTACGCTTGGTGCTTGCTTTCTCCAGCCATCGGAGACCAGAG
CCGCCCCCTCTGCTCGAGAAAGGGGCTCAGCGGCGGCGGAAGCGGAGGGGGACCACCGTG
GAGAGCGCGGTCCCAGCCCGGCCACTGCGGATCCCTGAAACCAA
gtaagagcgcttcccgcgccaccccctccccgaagcggttcgcgagaaagcgggagcgtc
cctatggggtctccaggcttcgtcctgcgcggggctgcctctcgacagtgcctgggggtt
cccaaagacttcttgcggggagcgatgcgaggacgtgcaggctaacgggtcctcctgccg
EXON 2  438 bp
gtaggtaaaggaggtgggacctcccagccctgcatggtggaaatgtaggagtggggctgg
attggcgtcgagaatggacgagctttccatattaagccaaggggtatgaaatcgctggtt
ctctatgtaggtctccgtagccccacgttcccatcctaacgcatctctcctctcttccag
AAAGCTCCTGCTGCTTCTGTACCCCGCCTGTCCCTCCCAGCTGCGCAGGGCCCCTTCGTG
GGATCATCAGCCCGAAGACAGGGATGGAGAGGCCTCTGTGCTCCCACCTCTGCAGCTGCC
TGGCTATGCTGGCCCTCCTGTCCCCCCTGAGCCTGGCACAGTATGACAGCTGGCCCCATT
ACCCCGAGTACTTCCAGCAACCGGCTCCTGAGTATCACCAGCCCCAGGCCCCCGCCAACG
TGGCCAAGATTCAGCTGCGCCTGGCTGGGCAGAAGAGGAAGCACAGCGAGGGCCGGGTGG
AGGTGTACTATGATGGCCAGTGGGGCACCGTGTGCGATGACGACTTCTCCATCCACGCTG
CCCACGTCGTCTGCCGGGAGCTGGGCTACGTGGAGGCCAAGTCCTGGACTGCCAGCTCCT
CCTACGGCAAGGGAGAAG
gtaaacgctctgtgctttggatctgagtgctgtcacctggcaaggcccggagtggccttc
cctgaggtcagcctgggagaggaggctgcacgcactgcgaagtgtaaattcttggtgatg
cccatccagggactggcatccttctgtgcccactcaggctgcaccctgcaggaaggcggg
EXON 3  176 bp
tccaggaatccccatggtttagagttatgtgcaatatcttaatataataaaaatggatgg
ccacacacagctgccaaaattagagaaaaattctctttccatgtgagacactggtgcccc
gcaaagactcagacctgcattgacgcagcacttggtttctctcctctctgcctccttcag
GGCCCATCTGGTTAGACAATCTCCACTGTACTGGCAACGAGGCGACCCTTGCAGCATGCA
CCTCCAATGGCTGGGGCGTCACTGACTGCAAGCACACGGAGGATGTCGGTGTGGTGTGCA
GCGACAAAAGGATTCCTGGGTTCAAATTTGACAATTCGTTGATCAACCAGATAGAG
gcaagtcatgtgctcttgatgtttccttcatgcaaacatttttcctcttccatgcaactc
gctttttgcgtattgatttcaagaagtgtgtgtgagcaggaaggagggtacctcacccaa
tgggattagatacaagggcagtttagggaaggatttctggagaagggaatcccatccatg
EXON 4  212 bp
ctaactgcagcttgggccgtgtgcccctcggggttgcccagagctcactgcagggcctga
gggcacaggcaggcccgcggcaggcctggcccatagtcgctaaagaagtactggttgcct
ggtgtctctgcagccaggccagtagggtaaccctctccttccacgcctctttcttcccag
AACCTGAATATCCAGGTGGAGGACATTCGGATTCGAGCCATCCTCTCAACCTACCGCAAG
CGCACCCCAGTGATGGAGGGCTACGTGGAGGTGAAGGAGGGCAAGACCTGGAAGCAGATC
TGTGACAAGCACTGGACGGCCAAGAATTCCCGCGTGGTCTGCGGCATGTTTGGCTTCCCT
GGGGAGAGGACATACAATACCAAAGTGTACAA
gtaagaggactgcaccaaaggggtggctttgagggtatccgccctgcctaaaagagttaa
aagtgtccgccctggtggtggcctttccttggccaggcatggccaggcaagctggtgtcc
ctgcaggcagcctgcacagagcccctgggccgggccaggcgccaagttcaagggtgcccc
EXON 5  223 bp
ggtgcaggcattagcaggtgctcagtgaatgctggcagaatggactgagctgggaccctc
tgtgaagcagggctgagctccaggagcagggcccagtctctcatgttctgcctcgttgca
gaaggaatcggggtaggcgtcatgatgccctggtcccctgtcccctcccatcgtctgcag
AATGTTTGCCTCACGGAGGAAGCAGCGCTACTGGCCATTCTCCATGGACTGCACCGGCAC
AGAGGCCCACATCTCCAGCTGCAAGCTGGGCCCCCAGGTGTCACTGGACCCCATGAAGAA
TGTCACCTGCGAGAATGGGCTACCGGCCGTGGTGAGTTGTGTGCCTGGGCAGGTCTTCAG
CCCTGACGGACCCTCAAGATTCCGGAAAGCGTACAAGCCAGAG
gtgaggacggggcacgaggtgtggccacttggcacctggaggggatgggagggtgttgag
ggagtaggcaggatcccccaggagagtgaggaagggtggcctcagcggagatcaccattg
tggctgctttactctgagacctgagcgccctctgcagagaaggaccacctgggggagaag
EXON 6  184 bp
cacacacacacacacacacacacacacacacacacatccatacatcaagcatagttgcag
ctcccagactgagtgcctggcctgggaacagggtggcagggaagggagggggcggggaca
gtggtcacccgctgaacgtgcatcagcgtctgtactcagcaggaccgtgtgtctcttcag
CAACCCCTGGTGCGACTGAGAGGCGGTGCCTACATCGGGGAGGGCCGCGTGGAGGTGCTC
AAAAATGGAGAATGGGGGACCGTCTGCGACGACAAGTGGGACCTGGTGTCGGCCAGTGTG
GTCTGCAGAGAGCTGGGCTTTGGGAGTGCCAAAGAGGCAGTCACTGGCTCCCGACTGGGG
CAAG
gtaaggaatggggaggctagagggggcctctcttcctgggagcatggtgccgtgagccca
gcctggctgctggccgtgagctctcgggaaatcctcactttccctcctccctttagtggc
tgcctgggagagaatcccaggcctctccctagacagagttgaaaggggccttagagaaca
EXON 7  152 bp
agagaattagcactgttctctctggggagaagaggcttgggtcattgagctgattacaag
aggcagtggggagagttctgaggatgggagaggcatgttcttattgtccagggctttctt
gccactccagaaagtttccttccaaagctttcatagagcatgtttattctccccttgcag
GGATCGGACCCATCCACCTCAACGAGATCCAGTGCACAGGCAATGAGAAGTCCATTATAG
ACTGCAAGTTCAATGCCGAGTCTCAGGGCTGCAACCACGAGGAGGATGCTGGTGTGAGAT
GCAACACCCCTGCCATGGGCTTGCAGAAGAAG
gtgatgggactggacacctagaggggactgtaactgaggctgcagaaagtatagccacag
agctctggggtgaaccctggaagtgaccaggtgctgctgctagtactgctgcagacattg
ccacttggcatttgcaatgtttagttccccctcgaacctcgggcctggccctggcccggc
EXON 8  168 bp
ctataagaccatgctaggcacagcgctgccaccgggggctcccaagggtgctgctgaatc
tgagtgtgtcccgggcagcaccacctggcttaggactccaggacactggggctgatggca
gcgtaggggggaagctcccttgtccctcttggtgaccgtggcctgcctttgtgtctgcag
CTGCGCCTGAACGGCGGCCGCAATCCCTACGAGGGCCGAGTGGAGGTGCTGGTGGAGAGA
AACGGGTCCCTTGTGTGGGGGATGGTGTGTGGCCAAAACTGGGGCATCGTGGAGGCCATG
GTGGTCTGCCGCCAGCTGGGCCTGGGATTCGCCAGCAACGCCTTCCAG
gtgagaagccccggcctcagaccccgcattcaccccccatgcagtctgaccacactgtct
tcagtcagcccccctctcccacgtaccctccctagccgtgcaggcaggacagagcaagtt
gccctggacccagaggcagggagcctcgctctggccacagcgctgctccttacaggcctg
EXON 9  166 bp
tcccactcactctgccaccaactaactgcacagcttggataggtgaccctccgtgctgtt
tcgatctgaaaaatgggatcatgaaacattgggatttttgtgaggctgcaagttgatagg
atatgagaaagtgacagtttgagatgatgtacccaccatttgttttgttggttcttccag
GAGACCTGGTATTGGCACGGAGATGTCAACAGCAACAAAGTGGTCATGAGTGGAGTGAAG
TGCTCGGGAACGGAGCTGTCCCTGGCGCACTGCCGCCACGACGGGGAGGACGTGGCCTGC
CCCCAGGGCGGAGTGCAGTACGGGGCCGGAGTTGCCTGCTCAGAAA
gtgagagctcctcccctccctccccaccgggctcccaaggggaccagagtcccaccagtt
attcctcaagagactctgaagccttgccatgagccaagcaatagaggaaggtagaatgaa
atcctaagggagaaaaactgggggcaagagagatgaccgccaccccaaccacagatcgct
EXON 10  244 bp
agcagaggaaaagaggaattcagggtcttgctaaacaagaaggtaaccttgaggagccct
tgagtcattccagaaggtggcggtaggcaggagagggggtttgtcccagctcaagaatca
gaagtagaagccctggggaggggtctcttgccttgttgaccagcatgccatcctccgcag
CCGCCCCTGACCTGGTCCTCAATGCGGAGATGGTGCAGCAGACCACCTACCTGGAGGACC
GGCCCATGTTCATGCTGCAGTGTGCCATGGAGGAGAACTGCCTCTCGGCCTCAGCCGCGC
AGACCGACCCCACCACGGGCTACCGCCGGCTCCTGCGCTTCTCCTCCCAGATCCACAACA
ATGGCCAGTCCGACTTCCGGCCCAAGAACGGCCGCCACGCGTGGATCTGGCACGACTGTC
ACAG
gtaggcctggctggccaccctccccactaagctgcccggcggacatcctgcaggcctcag
atgggagttgagagttgccagggtcacttagagccaagaggctgcatggcctggggatag
gatcctcctaagtggggggcttgcatctgccacactggctgtcagatttcccgaagccat
EXON 11  116 bp
tgaagctgcctctgcagcaccggctttcctttcctcaggcctctcatccactcctctccc
cacccggccccctctggtcccctggaagtattcccagaggcaaatcgccagccaggcctc
tgcttgcaagcagcagttgctccagaaactgacctccaggccatctctctctcgctccag
GCACTACCACAGCATGGAGGTGTTCACCCACTATGACCTGCTGAACCTCAATGGCACCAA
GGTGGCAGAGGGCCACAAGGCCAGCTTCTGCTTGGAGGACACAGAATGTGAAGGAG
gtatctgagcggagtggggggatgggaggcctcagagggactcgaatgcctctgcctcca
cgatcacctggctggagcccaggcctggcactgaccctgtgtcactctgaccactgccac
ctttccccacctggaccttcctcagctatagtgaggcgctgggggcatgggcatgacctg
EXON 12  137 bp
gatgtgggtagggaattgagtggggggttctactgaaatgagaacagatgagcagcccac
acagtggggtgggatgccgagcccagatgaagcagcggtaggggccttggaagcaggaag
agggtgcggcagtggggccatggttccctggtgatgagctctcctctaccctgcccgcag
ACATCCAGAAGAATTACGAGTGTGCCAACTTCGGCGATCAGGGCATCACCATGGGCTGCT
GGGACATGTACCGCCATGACATCGACTGCCAGTGGGTTGACATCACTGACGTGCCCCCTG
GAGACTACCTGTTCCAG
gtgaggtgggtgggaaggggttccagccctgcagggggaggaggggaggccacctccaca
ggctccttcccattggtgtccacacaggggcatggaagtcaggctgtctaaagggcaagg
tgctacccccagaggccatcacggtccatcagttaacccaaagatatcaggcatgggggc
EXON 13  112 bp
gctccctgactcatctcttcccctccccaaggactttgttgagacccacagacccccgtc
ttgggtcccggcacctgccacgctccccttccctgaggtgctggtctctcagagccccag
gcctgggtggaggtggccgcagagggaacaagcagcctcctctgccctgcttctccctag
GTTGTTATTAACCCCAACTTCGAGGTTGCAGAATCCGATTACTCCAACAACATCATGAAA
TGCAGGAGCCGCTATGACGGCCACCGCATCTGGATGTACAACTGCCACATAG
gtaaggccaggccgcccccactccaggaagcaggcgggagctgccctactttctcaagga
cccagaggcagcttcctaatttgggtaaagagctcggggaatgcagccagcatcacattt
ccacattcaggacagaagccacagacacacaggcctggatggagactgagtttttacagc
EXON 14  940 bp
tgacagagcacctgctatgtgcccagccctagagatggccagtgcctggcacctgtcctt
ttgaggagggcacacacaggtggccccagcagcccctgaggcccactcccctggctcagg
gtcaggcaaggcccgagcatctcatttgtccactctctctacccgattctcgctcttcag
GTGGTTCCTTCAGCGAAGAGACGGAAAAAAAGTTTGAGCACTTCAGCGGGCTCTTAAACA
ACCAGCTGTCCCCGCAGTAAAGAAGCCTGCGTGGTCAACTCCTGTCTTCAGGCCACACCA
CATCTTCCATGGGACTTCCCCCCAACAACTGAGTCTGAACGAATGCCACGTGCCCTCACC
CAGCCCGGCCCCCACCCTGTCCAGACCCCTACAGCTGTGTCTAAGCTCAGGAGGAAAGGG
ACCCTCCCATCATTCATGGGGGGCTGCTACCTGACCCTTGGGGCCTGAGAAGGCCTTGCG
GGGGTGGGGTTTGTCCACAGAGCTGCTGGAGCAGCACCAAGAGCCAGTCTTGACCGGGAT
GAGGCCCACAGACAGGTTGTCATCAGCTTGTCCCATTCAAGCCACCGAGCTCACCACAGA
CACAGTGGAGCCGCGCTCTTCTCCAGTGACACGTGGACAAATGCGGGCTCATCAGCCCCC
CCAGAGAGGGTCAGGCCGAACCCCATTTCTCCTCCTCTTAGGTCATTTTCAGCAAACTTG
AATATCTAGACCTCTCTTCCAATGAAACCCTCCAGTCTATTATAGTCACATAGATAATGG
TGCCACGTGTTTTCTGATTTGGTGAGCTCAGACTTGGTGCTTCCCTATCCACAGCCCCCA
CCCCTTGTTTTTCAAGATACTATTATTATATTTTCACAGACTTTTGAAGCACAAATTTAT
TGGCATTTAATATTGGACATCTGGGCCCTTGGAAGTACAAATCTAAGGAAAAACCAACCC
ACTGTGTAAGTGACTCATCTTCCTGTTGTTCCAATTCTGTGGGTTTTTGATTCAACGGTG
CTATAACCAGGGTCCTGGGTGACAGGGCGCTCACTGAGCACCATGTGTCATCACAGACAC
TTACACATACTTGAAACTTGGAATAAAAGAAAGATTTATG
aaacgtgtctgtgtttcctttgacccacagcacctgggccctgagcagcaggcttcctat
gttcagtggccagaagcagagcttcaggtacattcgtggttttctccggtggacatgggt
cctcagatcccctccagcccagtgtggccaccagggcacctccttcaatagactccaaaa