Gene FZD3 Variant 1
DNA : 70.19 KbNT_023666
mRNA : 3910 bp NM_017412
CDS : 2001 bp NP_059108
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  88 bp
caacgaggcgcgccgggccaggcccgcaagcccaggatccggcagggagctttcggccga
gcgtactcagtgcgcctgccccgtgcgtgcgcgcgcgctcgtgagctcgctctccgggcc
gcgcgccccggtgctcgcgaaagctcgctgtcgctgggaggcgcgcgccggcgttcctcg
GCCGCTCCGGGTACCTGAGGGACGCGCGGCCGCCCGCGGCAGGCGGTGCAGCCCCCCCAC
CCCTTGGAGCCAGGCGCCGGGGTCTGAG
gtgagccccgcgaagcgtgtgggcccctgggccggggcagcgggagaaggagcggcgagt
gtggagcccgaggaggcgccgcgcggctgcctgctgctccgcctcagcccgcgccgagga
gccagcagcagcccggcgcctcctcctcagggatcgttcctctcgtcgcggccacaacaa
EXON 2  46 bp
agtgaagttgaatatcttttcatatgtttcttggctgtttgtatttcttttgtaaattta
tgtcctttgcttatttttctattaaaatgttatcccctatctgcttttatttttaaaatt
catttactgtatataattacataaacaatacctttattctttttaattattctgttctag
GATAGCATTTCTCAAGACCTGACTTATGGAGCACTTGTAACCTGAG
gtaatcattagaatgcatatcattctccaggattcagatttccaggggaatccatgaatc
tgctacactttacgattagagaactgctgttttgggggaaatgaaaattctttaacacct
atactttacctgttttcttcatgtctcactgaattccactgctgttttttcccttctttt
EXON 3  533 bp
ttttagtgtagctatagcataaatgataaagtagaaaaatgatatctttataaagtaccc
acatattgttaactattaggtcagtataatatctctcatcaaagatttttaatgtcaagt
ccataatactttgagaggaaatgactaatttctcccattttttaaaataatacttttcag
ATATTTCAGTTGAAGGAAGAAATAGCTCTTCTCCTAAGATGGAATCTGTGGTTTGGGAAT
GTGGTTGATCAACTTGATATGTTGGCCAAATGTGCCCCATGTAATAAAATGAAAAGAAGA
GACAAGATGATGTCATTTTCCCATATTGTGAAACCAAAAACAAACGCCTTTTGTGAGACC
AAGCTAACAAACCTCTGACGGTGCGAAGAGTATTTAACTGTTTGAAGAATTTAACAGTAA
GATACAGAAGAAGTACCTTCGAGCTGAGACCTGCAGGTGTATAAATATCTAAAATACATA
TTGAATAGGCCTGATCATCTGAATCTCCTTCAGACCCAGGAAGGATGGCTATGACTTGGA
TTGTCTTCTCTCTTTGGCCCTTGACTGTGTTCATGGGGCATATAGGTGGGCACAGTTTGT
TTTCTTGTGAACCTATTACCTTGAGGATGTGCCAAGATTTGCCTTATAATACTACCTTCA
TGCCTAATCTTCTGAATCATTATGACCAACAGACAGCAGCTTTGGCAATGGAG
gtaagacttgatctattctttgacgtatcttagtaaatgactcttgtgttgtcccatcag
ccaatctaatgaatgtgtttgataaacaacaggaaaataatatgctattttaaattatat
cttataaatttaaaaatgtatatgttttgcttcagactctaatagattgaagaattcaca
EXON 4  197 bp
tagaatcttcaagggtagggctaggacagttttgtttaaaaaaacaaaaactccccttca
gaaaattttaataaccctcagaattttcttgtaatgagaaagagaatgttgcagtattat
agaaagctttaacttgtatacagctctttaactaattattcaattttaacttttccctag
CCATTCCACCCTATGGTGAATCTGGATTGTTCTCGGGATTTCCGGCCTTTTCTTTGTGCA
CTCTACGCTCCTATTTGTATGGAATATGGACGTGTCACACTTCCCTGTCGTAGGCTGTGT
CAGCGGGCTTACAGTGAGTGTTCGAAGCTCATGGAGATGTTTGGTGTTCCTTGGCCTGAA
GATATGGAATGCAGTAG
gtgcgaaaatcatagattttcatggatcatttcttatgttgcaatatgtttaaaagtact
tgtcttcttttccatctgttttaaaaaactttttttgaagtgtacatattagtcattaat
tttgaacagttttatggcctcacaattgtttatttgcttagaaatttggaagcactaaat
EXON 5  1018 bp
tcgaaaatctagttgtatggaccacaaacaagatatcaccatttactttatttctacata
ttacatttgctctccaggaataaataaggttgtgagtgccagatttggaaatccaaactg
ttagatcgtgatagatttccccataagtaaaaatagttctcatcttgttttgttttttag
GTTCCCAGATTGTGATGAGCCATATCCTCGACTTGTGGATCTGAATTTAGCTGGAGAACC
AACTGAAGGAGCCCCAGTGGCAGTGCAGAGAGACTATGGTTTTTGGTGTCCCCGAGAGTT
AAAAATTGATCCTGATCTGGGTTATTCTTTTCTGCATGTGCGTGATTGTTCACCTCCTTG
TCCAAATATGTACTTCAGAAGAGAAGAACTGTCATTTGCTCGCTATTTCATAGGATTGAT
TTCAATCATTTGCCTCTCGGCCACATTGTTTACTTTTTTAACTTTTTTGATTGATGTCAC
AAGATTCCGTTATCCTGAAAGGCCTATTATATTTTATGCAGTCTGCTACATGATGGTATC
CTTAATTTTCTTCATTGGATTTTTGCTTGAAGATCGAGTAGCCTGCAATGCATCCATCCC
TGCACAATATAAGGCTTCCACAGTGACACAAGGATCTCATAATAAAGCCTGTACCATGCT
TTTTATGATACTCTATTTTTTTACTATGGCTGGCAGTGTATGGTGGGTAATTCTTACCAT
CACATGGTTTTTAGCAGCTGTGCCAAAGTGGGGTAGTGAAGCTATTGAGAAGAAAGCATT
GCTGTTTCACGCCAGTGCATGGGGCATCCCCGGAACTCTAACCATCATCCTTTTAGCGAT
GAATAAAATTGAAGGTGACAATATTAGTGGCGTGTGTTTTGTTGGCCTCTACGATGTTGA
TGCATTGAGATATTTTGTTCTTGCTCCCCTCTGCCTGTATGTGGTAGTTGGGGTTTCTCT
CCTCTTAGCTGGCATTATATCCCTAAACAGAGTTCGAATTGAGATTCCATTAGAAAAGGA
GAACCAAGATAAATTAGTGAAGTTTATGATCCGGATCGGTGTTTTCAGCATTCTTTATCT
CGTACCACTCTTGGTTGTAATTGGATGCTACTTTTATGAGCAAGCTTACCGGGGCATCTG
GGAAACAACGTGGATACAAGAACGCTGCAGAGAATATCACATTCCATGTCCATATCAG
gtaagggaaaccttgttacaaatttcagaatatatgataatgaaacaaaagcatattact
ataatgagttaatatcagctgttttttgaaatgtcatgaaccttcaacttgtacattaac
attttaaggatgagatgacaaatatgttgtagtaaatatgtaatacacatatttgataga
EXON 6  149 bp
ggagaattgcttgaacctgggaggcagaggttgcagtgagccaagatcacaccattgcac
tccagcctgggtgacaagaacaaaactctgtctcaaaagaaaaagaaaaagatttcataa
tggcctttaatagaaagttatttttatatatttaagatgcttttctttctgttcttccag
GTTACTCAAATGAGTCGTCCAGACTTGATTCTCTTTCTGATGAAATACCTGATGGCTCTC
ATAGTTGGCATTCCCTCTGTATTTTGGGTTGGAAGCAAAAAGACATGCTTTGAATGGGCC
AGTTTTTTTCATGGTCGTAGGAAAAAAGA
gtaagttgaaataaatgatcacagtgttcacaaacctcacatttacgtaaatttttttgt
gttgcttatgttaaaatgacttggatttggagaattattcaaacaagactaacattttca
gcagtatccagttatgattggcacagtagcatgtcttaatttaaaactaaaaacttattt
EXON 7  234 bp
attgacatagattgttgttctattctttcctctgtcaacaatgtttcttcatgtcagtcc
tatagatctaatttggcaagcaattaatttcaagaataatatcagtgtttcagagaagta
ttgcttattggtctgaaggaagattggtatgtatcttaaacttactattttgttgtctag
GATAGTGAATGAGAGCCGACAGGTACTCCAGGAACCTGATTTTGCTCAGTCTCTCCTGAG
GGATCCAAATACTCCTATCATAAGAAAGTCAAGGGGAACTTCCACTCAAGGAACATCCAC
CCATGCTTCTTCAACTCAGCTGGCTATGGTGGATGATCAAAGAAGCAAAGCAGGAAGCAT
CCACAGCAAAGTGAGCAGCTACCACGGCAGCCTCCACAGATCACGTGATGGCAG
gtgagttttgttagtagtgtagtttatttcataagctgaattatgaccatacagcttaag
aaagaggagcagccaattctgaaatagaagtcgaacataattaagcctttgaactttgct
agatagagttgtcccagactatggtcagacttaaagtcagtcagaattgtttagatttga
EXON 8  1645 bp
ttggccatgtcaataattctacagtgttaacgaagttaagcaatcaaaagttggttatta
ctttctcatggttggtttcctaataatttcccttactgaggcatttttatgaaaattatt
agtgttattatattttctagtgtgttctgttacccacttcaaaataaactctcatgacag
GTACACGCCCTGCAGTTACAGAGGAATGGAGGAGAGACTACCTCATGGCAGCATGTCACG
ACTAACAGATCACTCCAGGCATAGTAGTTCTCATCGGCTCAATGAACAGTCACGACATAG
CAGCATCAGAGATCTCAGTAATAATCCCATGACTCATATCACACATGGCACCAGCATGAA
TCGGGTTATTGAAGAAGATGGAACCAGTGCTTAATTTGTCTTGTCTAAGGTGGAAATCTT
GTGCTGTTTAAAAAGCAGATTTTATTCTTTGCCTTTTGCATGACTGATAGCTGTAACTCA
CAGTTAACATGCTTTCAGTCAAGTACAGATTGTGTCCACTGGAAAGGTAAATGATTGCTT
TTTTATATTGCATCAAACTTGGAACATCAAGGCATCCAAAACACTAAGAATTCTATCATC
ACAAAAATAATTCGTCTTTCTAGGTTATGAAGAGATAATTATTTGTCTGGTAAGCATTTT
TATAAACCCACTCATTTTATATTTAGAAAAATCCTAAATGTGTGGTGACTGCTTTGTAGT
GAACTTTCATATACTATAAACTAGTTGTGAGATAACATTCTGGTAGCTCAGTTAATAAAA
CAATTTCAGAATTAAAGAAATTTTCTATGCAAGGTTTACTTCTCAGATGAACAGTAGGAC
TTTGTAGTTTTATTTCCACTAAGTGAAAAAAGAACTGTGTTTTTAAACTGTAGGAGAATT
TAATAAATCAGCAAGGGTATTTTAGCTAATAGAATAAAAGTGCAACAGAAGAATTTGATT
AGTCTATGAAAGGTTCTCTTAAAATTCTATCGAAATAATCTTCATGCAGAGATATTCAGG
GTTTGGATTAGCAGTGGAATAAAGAGATGGGCATTGTTTCCCCTATAATTGTGCTGTTTT
TATAACTTTTGTAAATATTACTTTTTCTGGCTGTGTTTTTATAACTTATCCATATGCATG
ATGGAAAAATTTTAATTTGTAGCCATCTTTTCCCATGTAATAGTATTGATTCATAGAGAA
CTTAATGTTCAAAATTTGCTTTGTGGAGGCATGTAATAAGATAAACATCATACATTATAA
GGTAACCACAATTACAAAATGGCAAAACATTTTCTCTGTATTCATTGTTGTATTTTTCTA
CAGTGAGATGTGATCTTGCCAAAGCCACCAGACCTTGGCTTCCAGGCCCTCCTGTAGTGA
GTTGATTGTCTGCACTTGCCTTGCCCAATAGCCAGTAGGCTACAGCTTTTGCCCCACACC
CTTATTTTCAGATTCTGGATCATTCTTGTTTACAACTGAAATATATATAACCTCAGTCCA
AAGTGGTGATTGATTTGAGTATTTGAAAATTGTTGTAGCTAAATGAAGCATGATTAGTCT
TAGTATGAATATCATTTAATCTTTAAAAAATCAAGTAAAAATGTTTATCTGATAATGTTT
AAATAATTTACAATATAAACTGTAAAACTTATTAGGCATGAAATCAATCAGAAGAGAAAG
AAAAATGCTGGAACATGCTTGATGTATTATGTAAAAAGCATATTTAAACAAGGGTCCTCA
ACCCTGACTGCAGATAAGAATCACTTGGGTTACTTCAGATGCCTAACACCTTCCTCTCAT
ACAAATAAGAATTGGTAGCTTTCTT
aaaaaaaaaaaaaaaaaaaaaaagcgctccaggtgattctaatctgcagcctggcttgaa
actcactactttaacttgcccctgatgatctgtcggcatcatatatcacatgaacatcca
catggattctgtctttcgcttttatatcattatctaatattcagttgttctgcacctgat