Gene FGFR1 Variant 9
DNA : 42.44 KbNT_008251
mRNA : 1552 bp NM_023110
CDS : 453 bp NP_075598
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  638 bp
gtaggaagagaagggcagagcgccggacagctcggcccgctccccgtcctttggggccgc
ggctggggaactacaaggcccagcaggcagctgcagggggcggaggcggaggagggacca
gcgcgggtgggagtgagagagcgagccctcgcgccccgccggcgcatagcgctcggagcg
CTCTTGCGGCCACAGGCGCGGCGTCCTCGGCGGCGGGCGGCAGCTAGCGGGAGCCGGGAC
GCCGGTGCAGCCGCAGCGCGCGGAGGAACCCGGGTGTGCCGGGAGCTGGGCGGCCACGTC
CGGACGGGACCGAGACCCCTCGTAGCGCATTGCGGCGACCTCGCCTTCCCCGGCCGCGAG
CGCGCCGCTGCTTGAAAAGCCGCGGAACCCAAGGACTTTTCTCCGGTCCGAGCTCGGGGC
GCCCCGCAGGGCGCACGGTACCCGTGCTGCAGTCGGGCACGCCGCGGCGCCGGGGCCTCC
GCAGGGCGATGGAGCCCGGTCTGCAAGGAAAGTGAGGCGCCGCCGCTGCGTTCTGGAGGA
GGGGGGCACAAGGTCTGGAGACCCCGGGTGGCGGACGGGAGCCCTCCCCCCGCCCCGCCT
CCGGGGCACCAGCTCCGGCTCCATTGTTCCCGCCCGGGCTGGAGGCGCCGAGCACCGAGC
GCCGCCGGGAGTCGAGCGCCGGCCGCGGAGCTCTTGCGACCCCGCCAGGACCCGAACAGA
GCCCGGGGGCGGCGGGCCGGAGCCGGGGACGCGGGCACACGCCCGCTCGCACAAGCCACG
GCGGACTCTCCCGAGGCGGAACCTCCACGCCGAGCGAG
gtaagagccgcggcgcccccggatctggggcgggcttggcgtcccgagcggcccccggcg
ccggagcctcccggctgcgcgctttgcccgccgcagcccagccggggccggcgcctccct
ccgctcgccgcccgcccctttcacctcctggctccctcccgggcgatccgcgccccttgg
EXON 2  179 bp
acacccagccaggacctatgatctaattcattgttggggtagcttcacaattttcttctg
gacgccttagtaagtccacactttaagcagccaccacatggcatactttaccttctgttt
ttcctttcccctcccctacctagaccctcctaacttttggggtttttttcctttcctcag
GGTCAGTTTGAAAAGGAGGATCGAGCTCACTGTGGAGTATCCATGGAGATGTGGAGCCTT
GTCACCAACCTCTAACTGCAGAACTGGGATGTGGAGCTGGAAGTGCCTCCTCTTCTGGGC
TGTGCTGGTCACAGCCACACTCTGCACCGCTAGGCCGTCCCCGACCTTGCCTGAACAAG
gtaaggtgctggctgggggcagcctggactcctgggccttgggaacaggatgggctggga
gggaggtgatatggttgcaggtgatgtggtcaacagggaaggctccttcccaagtggagc
aaagaactcccttcctgtaggagaaactctcaagatacctgggttggttctggtctggtt
EXON 3  267 bp
tccccactgacccatgctccaattcccactgccctggctcagtagcctccagtaagtgat
gcccaggatggtgcggctccgtgtggccagcgtaattccctttgtctctcccctcctccc
ctctccctgtcttcctctctcgccccttggcttcccttcccggccccgtggtggctgcag
CCCAGCCCTGGGGAGCCCCTGTGGAAGTGGAGTCCTTCCTGGTCCACCCCGGTGACCTGC
TGCAGCTTCGCTGTCGGCTGCGGGACGATGTGCAGAGCATCAACTGGCTGCGGGACGGGG
TGCAGCTGGCGGAAAGCAACCGCACCCGCATCACAGGGGAGGAGGTGGAGGTGCAGGACT
CCGTGCCCGCAGACTCCGGCCTCTATGCTTGCGTAACCAGCAGCCCCTCGGGCAGTGACA
CCACCTACTTCTCCGTCAATGTTTCAG
gttggtagccaagccctgcccttgcccctccctagacccaccccctccagccctctctgc
cagtttcagaggaaggtgaacctcctccccctccgtgatctgcccccactctgcttcaga
aactgctgcccactaacattgctccctgcctgccgcgtggcttggctctcagagaggtga
EXON 4  144 bp
tgcttcagaaactgctgcccactaacattgctccctgcctgccgcgtggcttggctctca
gagaggtgactaggtggggtgggccccagggccggagatctggggcttccaggacacacc
tcggaggtgattgccagggctcttgggatgttaagaccctgtgatttttttccaccacag
CTTGCCCAGATCTCCAGGAGGCTAAGTGGTGCTCGGCCAGCTTCCACTCCATCACTCCCT
TGCCATTTGGACTTGGTACTCGGCTTAGTGATTAGAGGCCCTGAACAGGTGGTGGTATCC
CTGCTCTGCTGGAGAGGAACCCAG
gtgcaccgcaagggagctgtgcgagggcagccagggagccctggagctctgtgaacttgg
gaacttgccactcttagaatgtgactttcacaaaactaggagttgaggaagtggagctga
aattttctttatgccatttatgcacctcagggtgtggacttggcagcagatccccaaagg
EXON 5  84 bp
caaacacgcacaggaactgttcttaaacagtttccatcccaccaagagatcatcactaag
ggagcagtgggactgggatccccatggggagggtgtccgtgttcatctggaactgcacta
gccttggtgaaatctaggggtccctaggaggaacctcagtgccccttcttcttcccatag
ATGCTCTCCCCTCCTCGGAGGATGATGATGATGATGATGACTCCTCTTCAGAGGAGAAAG
AAACAGATAACACCAAACCAAACC
gtatgcgtgagacactgtttcctatcttactgccctttgggtctgggcattgggtttaag
aggggaggggaaggctgaaaggggaggaagaggagggcacatggggtcacggtgcctgtt
ctgctaagtgccaggcactgctcacaggtgttgggcagatgggcaagacacctccaggtc
EXON 6  173 bp
aaggggaggaagaggagggcacatggggtcacggtgcctgttctgctaagtgccaggcac
tgctcacaggtgttgggcagatgggcaagacacctccaggtcctggcctgggccctgctc
ctgagcctgaccagctgctcctctccaccctgcctgtctctcttggctttccccgggcag
CCGTAGCTCCATATTGGACATCCCCAGAAAAGATGGAAAAGAAATTGCATGCAGTGCCGG
CTGCCAAGACAGTGAAGTTCAAATGCCCTTCCAGTGGGACCCCAAACCCCACACTGCGCT
GGTTGAAAAATGGCAAAGAATTCAAACCTGACCACAGAATTGGAGGCTACAAG
gtacgtgtgtgtgcatgcgaaagttagagtaatgggaacaggggaggccgagttaggaag
tcctgattacatgcttttcatttttttaagtaatactttccacctatacaggttattcat
taaaatttttaaatacaaaaaaatgcaaataaagtttaaacatttcttcagtcttctttc
EXON 7  67 bp
cagagtgtgaacgggctggtaggggggcaatccacgccttgtcctagccaaccctgcagc
ctggggccctgtgccaccaggctctgatatggagggcaggtgccacggggtgccgacatt
gtcatggggcctgcattttcctctggaccctcaatgtatccctttggcatttcccctcag
GTCCGTTATGCCACCTGGAGCATCATAATGGACTCTGTGGTGCCCTCTGACAAGGGCAAC
TACACCT
gcattgtggagaatgagtacggcagcatcaaccacacataccagctggatgtcgtgggta
agagggcagaggcagcaggaggaatgagtttagtgggaagagccaggcttggagaacaca
gccggggtgtccaggtttcttaggggcagagtcaggatagcgattggcacttcttggctt