Gene FGFR1 Variant 8
DNA : 45.28 KbNT_008251
mRNA : 2568 bp NM_023107
CDS : 909 bp NP_075595
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  638 bp
gtaggaagagaagggcagagcgccggacagctcggcccgctccccgtcctttggggccgc
ggctggggaactacaaggcccagcaggcagctgcagggggcggaggcggaggagggacca
gcgcgggtgggagtgagagagcgagccctcgcgccccgccggcgcatagcgctcggagcg
CTCTTGCGGCCACAGGCGCGGCGTCCTCGGCGGCGGGCGGCAGCTAGCGGGAGCCGGGAC
GCCGGTGCAGCCGCAGCGCGCGGAGGAACCCGGGTGTGCCGGGAGCTGGGCGGCCACGTC
CGGACGGGACCGAGACCCCTCGTAGCGCATTGCGGCGACCTCGCCTTCCCCGGCCGCGAG
CGCGCCGCTGCTTGAAAAGCCGCGGAACCCAAGGACTTTTCTCCGGTCCGAGCTCGGGGC
GCCCCGCAGGGCGCACGGTACCCGTGCTGCAGTCGGGCACGCCGCGGCGCCGGGGCCTCC
GCAGGGCGATGGAGCCCGGTCTGCAAGGAAAGTGAGGCGCCGCCGCTGCGTTCTGGAGGA
GGGGGGCACAAGGTCTGGAGACCCCGGGTGGCGGACGGGAGCCCTCCCCCCGCCCCGCCT
CCGGGGCACCAGCTCCGGCTCCATTGTTCCCGCCCGGGCTGGAGGCGCCGAGCACCGAGC
GCCGCCGGGAGTCGAGCGCCGGCCGCGGAGCTCTTGCGACCCCGCCAGGACCCGAACAGA
GCCCGGGGGCGGCGGGCCGGAGCCGGGGACGCGGGCACACGCCCGCTCGCACAAGCCACG
GCGGACTCTCCCGAGGCGGAACCTCCACGCCGAGCGAG
gtaagagccgcggcgcccccggatctggggcgggcttggcgtcccgagcggcccccggcg
ccggagcctcccggctgcgcgctttgcccgccgcagcccagccggggccggcgcctccct
ccgctcgccgcccgcccctttcacctcctggctccctcccgggcgatccgcgccccttgg
EXON 2  179 bp
acacccagccaggacctatgatctaattcattgttggggtagcttcacaattttcttctg
gacgccttagtaagtccacactttaagcagccaccacatggcatactttaccttctgttt
ttcctttcccctcccctacctagaccctcctaacttttggggtttttttcctttcctcag
GGTCAGTTTGAAAAGGAGGATCGAGCTCACTGTGGAGTATCCATGGAGATGTGGAGCCTT
GTCACCAACCTCTAACTGCAGAACTGGGATGTGGAGCTGGAAGTGCCTCCTCTTCTGGGC
TGTGCTGGTCACAGCCACACTCTGCACCGCTAGGCCGTCCCCGACCTTGCCTGAACAAG
gtaaggtgctggctgggggcagcctggactcctgggccttgggaacaggatgggctggga
gggaggtgatatggttgcaggtgatgtggtcaacagggaaggctccttcccaagtggagc
aaagaactcccttcctgtaggagaaactctcaagatacctgggttggttctggtctggtt
EXON 3  90 bp
caaacacgcacaggaactgttcttaaacagtttccatcccaccaagagatcatcactaag
ggagcagtgggactgggatccccatggggagggtgtccgtgttcatctggaactgcacta
gccttggtgaaatctaggggtccctaggaggaacctcagtgccccttcttcttcccatag
ATGCTCTCCCCTCCTCGGAGGATGATGATGATGATGATGACTCCTCTTCAGAGGAGAAAG
AAACAGATAACACCAAACCAAACCGTATGC
gtgagacactgtttcctatcttactgccctttgggtctgggcattgggtttaagagggga
ggggaaggctgaaaggggaggaagaggagggcacatggggtcacggtgcctgttctgcta
agtgccaggcactgctcacaggtgttgggcagatgggcaagacacctccaggtcctggcc
EXON 4  173 bp
aaggggaggaagaggagggcacatggggtcacggtgcctgttctgctaagtgccaggcac
tgctcacaggtgttgggcagatgggcaagacacctccaggtcctggcctgggccctgctc
ctgagcctgaccagctgctcctctccaccctgcctgtctctcttggctttccccgggcag
CCGTAGCTCCATATTGGACATCCCCAGAAAAGATGGAAAAGAAATTGCATGCAGTGCCGG
CTGCCAAGACAGTGAAGTTCAAATGCCCTTCCAGTGGGACCCCAAACCCCACACTGCGCT
GGTTGAAAAATGGCAAAGAATTCAAACCTGACCACAGAATTGGAGGCTACAAG
gtacgtgtgtgtgcatgcgaaagttagagtaatgggaacaggggaggccgagttaggaag
tcctgattacatgcttttcatttttttaagtaatactttccacctatacaggttattcat
taaaatttttaaatacaaaaaaatgcaaataaagtttaaacatttcttcagtcttctttc
EXON 5  124 bp
cagagtgtgaacgggctggtaggggggcaatccacgccttgtcctagccaaccctgcagc
ctggggccctgtgccaccaggctctgatatggagggcaggtgccacggggtgccgacatt
gtcatggggcctgcattttcctctggaccctcaatgtatccctttggcatttcccctcag
GTCCGTTATGCCACCTGGAGCATCATAATGGACTCTGTGGTGCCCTCTGACAAGGGCAAC
TACACCTGCATTGTGGAGAATGAGTACGGCAGCATCAACCACACATACCAGCTGGATGTC
GTGG
gtaagagggcagaggcagcaggaggaatgagtttagtgggaagagccaggcttggagaac
acagccggggtgtccaggtttcttaggggcagagtcaggatagcgattggcacttcttgg
ctttgtcaccttgagcaggtcacttctcccttttgagcctcacttttcttatctgtaaaa
EXON 6  1364 bp
agggcctgaagagagggtgtccctttccccagctctgttttgagaggcttgggctcagca
gaagtgctgggaggtttacaacccatcactgggaaagccaagtggggcgcaggtgagccc
acccctctttagccatggcaaggtccccatgacaagtgcctcctctcccatcttccacag
AGCGGTCCCCTCACCGGCCCATCCTGCAAGCAGGGTTGCCCGCCAACAAAACAGTGGCCC
TGGGTAGCAACGTGGAGTTCATGTGTAAGGTGTACAGTGACCCGCAGCCGCACATCCAGT
GGCTAAAGCACATCGAGGTGAATGGGAGCAAGATTGGCCCAGACAACCTGCCTTATGTCC
AGATCTTGAAGGTAATCATGGCACCAGTCTTCGTGGGCCAGTCTACTGGGAAGGAGACCA
CTGTCTCGGGGGCTCAAGTTCCTGTGGGCAGGCTCAGTTGCCCCCGAATGGGATCATTCC
TCACGCTTCAGGCACACACACTCCATCTCAGTAGGGATCTAGCCACATCCCCCAGGACTA
GTAACAGAGGTCACAAAGTGGAGGTGAGCTGGGAACAGAGGGCTGCAGGGATGGGTGGTG
CTGGTCTGTAATAAGCTTTGAGAGCAACGTCACTGGGGCTTTGGGGTCAGCTACACAAGG
AAGGCATTTGGACCCCTGCCTTTTCATTGCCCGAAACCAGAGCCTTTCCACCAAGCGTTT
CCCAGTCTTAGCCCTGTGTCCTGAGTTACGTACGATCTTTCTGGCAAATGGGGTGCATGA
TAAGAGCATCTCTTACGAAGAGTTGGAAAAACAAATGCCATATATAAATTCTAAGCCATA
TGAGGACGAGGAGTAATGGCATTTTCTTCCTTTTTCCTCTCACTCCCAGACATTCATTGT
CCCTGAATGCTCCATTAATCCAGGGAAGGTAATTGCCTAAATCTCCAGTGGATCTCGCAA
CAGGAAGGAACCAGAAGCTGGGAAAGTTGTTTACCTCTTTGTCCCAGAGTTAGACCTCAT
CCTCCCCTAGCTTAGCTGTCTCAGAGATATACTGGCCCTCCCTTCTCTTCTCTTTGCTGC
TGGTGCTAAAACTGCTCTGTAGGTCATTGGCCACTGTCTCCACTCACAACCCCTGCTCCA
GTCCTGGAGGGAGTGGGTTAAACACAAATAGAACATTCCATTTGAAGCAGTGATTCTTTT
TTTTTTTTTTTTTTTTTAATCAAATGCTTTGGACTTTTGAAGTCCACTTGTTCTGTACTT
GTAAAAGGGAAAGAAGGCCGGGCGCAGTGGCTCACGCCTGTAATCCCAGCACTTTAGATC
ACTTGAGGTCAGGAGTTTGAGACCAGCCCGGCCAACATGGTGAAACCCCATCTCTACTAA
AAATACAAAAATTAGCTGTGCATAGTGGTTGGCACCTGTAGTCCCAGCTACTCAGGAGGC
TGAGGCAAGCTAACTGCTTGAACCCAGAAGGCAGAGGTTGCAGTGAGCTGAGATCACGCC
ACTGCACTCCAGCCTGGGTGACAGAGTGAGTGAGACTCTGCGTT
aaaaaaaaaaaaaaaaaaaaaaactaaaagggaaaggtaataaatctcacttaacatctc
ccttcgctccctgggcctgcctgaaagttacacgggagcaacgtgcgtggccacatctca
gctttgcccaactgactggtgtgtcgttggtttgttccagcattcggggattaatagctc