Gene FGFR1 Variant 6
DNA : 55.84 KbNT_008251
mRNA : 4074 bp NM_023109
CDS : 1989 bp NP_075597
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  638 bp
gtaggaagagaagggcagagcgccggacagctcggcccgctccccgtcctttggggccgc
ggctggggaactacaaggcccagcaggcagctgcagggggcggaggcggaggagggacca
gcgcgggtgggagtgagagagcgagccctcgcgccccgccggcgcatagcgctcggagcg
CTCTTGCGGCCACAGGCGCGGCGTCCTCGGCGGCGGGCGGCAGCTAGCGGGAGCCGGGAC
GCCGGTGCAGCCGCAGCGCGCGGAGGAACCCGGGTGTGCCGGGAGCTGGGCGGCCACGTC
CGGACGGGACCGAGACCCCTCGTAGCGCATTGCGGCGACCTCGCCTTCCCCGGCCGCGAG
CGCGCCGCTGCTTGAAAAGCCGCGGAACCCAAGGACTTTTCTCCGGTCCGAGCTCGGGGC
GCCCCGCAGGGCGCACGGTACCCGTGCTGCAGTCGGGCACGCCGCGGCGCCGGGGCCTCC
GCAGGGCGATGGAGCCCGGTCTGCAAGGAAAGTGAGGCGCCGCCGCTGCGTTCTGGAGGA
GGGGGGCACAAGGTCTGGAGACCCCGGGTGGCGGACGGGAGCCCTCCCCCCGCCCCGCCT
CCGGGGCACCAGCTCCGGCTCCATTGTTCCCGCCCGGGCTGGAGGCGCCGAGCACCGAGC
GCCGCCGGGAGTCGAGCGCCGGCCGCGGAGCTCTTGCGACCCCGCCAGGACCCGAACAGA
GCCCGGGGGCGGCGGGCCGGAGCCGGGGACGCGGGCACACGCCCGCTCGCACAAGCCACG
GCGGACTCTCCCGAGGCGGAACCTCCACGCCGAGCGAG
gtaagagccgcggcgcccccggatctggggcgggcttggcgtcccgagcggcccccggcg
ccggagcctcccggctgcgcgctttgcccgccgcagcccagccggggccggcgcctccct
ccgctcgccgcccgcccctttcacctcctggctccctcccgggcgatccgcgccccttgg
EXON 2  179 bp
acacccagccaggacctatgatctaattcattgttggggtagcttcacaattttcttctg
gacgccttagtaagtccacactttaagcagccaccacatggcatactttaccttctgttt
ttcctttcccctcccctacctagaccctcctaacttttggggtttttttcctttcctcag
GGTCAGTTTGAAAAGGAGGATCGAGCTCACTGTGGAGTATCCATGGAGATGTGGAGCCTT
GTCACCAACCTCTAACTGCAGAACTGGGATGTGGAGCTGGAAGTGCCTCCTCTTCTGGGC
TGTGCTGGTCACAGCCACACTCTGCACCGCTAGGCCGTCCCCGACCTTGCCTGAACAAG
gtaaggtgctggctgggggcagcctggactcctgggccttgggaacaggatgggctggga
gggaggtgatatggttgcaggtgatgtggtcaacagggaaggctccttcccaagtggagc
aaagaactcccttcctgtaggagaaactctcaagatacctgggttggttctggtctggtt
EXON 3  267 bp
tccccactgacccatgctccaattcccactgccctggctcagtagcctccagtaagtgat
gcccaggatggtgcggctccgtgtggccagcgtaattccctttgtctctcccctcctccc
ctctccctgtcttcctctctcgccccttggcttcccttcccggccccgtggtggctgcag
CCCAGCCCTGGGGAGCCCCTGTGGAAGTGGAGTCCTTCCTGGTCCACCCCGGTGACCTGC
TGCAGCTTCGCTGTCGGCTGCGGGACGATGTGCAGAGCATCAACTGGCTGCGGGACGGGG
TGCAGCTGGCGGAAAGCAACCGCACCCGCATCACAGGGGAGGAGGTGGAGGTGCAGGACT
CCGTGCCCGCAGACTCCGGCCTCTATGCTTGCGTAACCAGCAGCCCCTCGGGCAGTGACA
CCACCTACTTCTCCGTCAATGTTTCAG
gttggtagccaagccctgcccttgcccctccctagacccaccccctccagccctctctgc
cagtttcagaggaaggtgaacctcctccccctccgtgatctgcccccactctgcttcaga
aactgctgcccactaacattgctccctgcctgccgcgtggcttggctctcagagaggtga
EXON 4  90 bp
caaacacgcacaggaactgttcttaaacagtttccatcccaccaagagatcatcactaag
ggagcagtgggactgggatccccatggggagggtgtccgtgttcatctggaactgcacta
gccttggtgaaatctaggggtccctaggaggaacctcagtgccccttcttcttcccatag
ATGCTCTCCCCTCCTCGGAGGATGATGATGATGATGATGACTCCTCTTCAGAGGAGAAAG
AAACAGATAACACCAAACCAAACCGTATGC
gtgagacactgtttcctatcttactgccctttgggtctgggcattgggtttaagagggga
ggggaaggctgaaaggggaggaagaggagggcacatggggtcacggtgcctgttctgcta
agtgccaggcactgctcacaggtgttgggcagatgggcaagacacctccaggtcctggcc
EXON 5  173 bp
aaggggaggaagaggagggcacatggggtcacggtgcctgttctgctaagtgccaggcac
tgctcacaggtgttgggcagatgggcaagacacctccaggtcctggcctgggccctgctc
ctgagcctgaccagctgctcctctccaccctgcctgtctctcttggctttccccgggcag
CCGTAGCTCCATATTGGACATCCCCAGAAAAGATGGAAAAGAAATTGCATGCAGTGCCGG
CTGCCAAGACAGTGAAGTTCAAATGCCCTTCCAGTGGGACCCCAAACCCCACACTGCGCT
GGTTGAAAAATGGCAAAGAATTCAAACCTGACCACAGAATTGGAGGCTACAAG
gtacgtgtgtgtgcatgcgaaagttagagtaatgggaacaggggaggccgagttaggaag
tcctgattacatgcttttcatttttttaagtaatactttccacctatacaggttattcat
taaaatttttaaatacaaaaaaatgcaaataaagtttaaacatttcttcagtcttctttc
EXON 6  124 bp
cagagtgtgaacgggctggtaggggggcaatccacgccttgtcctagccaaccctgcagc
ctggggccctgtgccaccaggctctgatatggagggcaggtgccacggggtgccgacatt
gtcatggggcctgcattttcctctggaccctcaatgtatccctttggcatttcccctcag
GTCCGTTATGCCACCTGGAGCATCATAATGGACTCTGTGGTGCCCTCTGACAAGGGCAAC
TACACCTGCATTGTGGAGAATGAGTACGGCAGCATCAACCACACATACCAGCTGGATGTC
GTGG
gtaagagggcagaggcagcaggaggaatgagtttagtgggaagagccaggcttggagaac
acagccggggtgtccaggtttcttaggggcagagtcaggatagcgattggcacttcttgg
ctttgtcaccttgagcaggtcacttctcccttttgagcctcacttttcttatctgtaaaa
EXON 7  191 bp
agggcctgaagagagggtgtccctttccccagctctgttttgagaggcttgggctcagca
gaagtgctgggaggtttacaacccatcactgggaaagccaagtggggcgcaggtgagccc
acccctctttagccatggcaaggtccccatgacaagtgcctcctctcccatcttccacag
AGCGGTCCCCTCACCGGCCCATCCTGCAAGCAGGGTTGCCCGCCAACAAAACAGTGGCCC
TGGGTAGCAACGTGGAGTTCATGTGTAAGGTGTACAGTGACCCGCAGCCGCACATCCAGT
GGCTAAAGCACATCGAGGTGAATGGGAGCAAGATTGGCCCAGACAACCTGCCTTATGTCC
AGATCTTGAAG
gtaatcatggcaccagtcttcgtgggccagtctactgggaaggagaccactgtctcgggg
gctcaagttcctgtgggcaggctcagttgcccccgaatgggatcattcctcacgcttcag
gcacacacactccatctcagtagggatctagccacatcccccaggactagtaacagaggt
EXON 8  145 bp
ccctcttcctctaacaggttttgctgcctggtggttttcgtttgttccttgttgcaaaga
agatgtcagggagcatttcttcctctagtcccccttctttctgtctccttcccttgctct
gcgtctcttagaggtctcatgtcctgtgcttgtccattttgcttccgttgtctcttctag
ACTGCTGGAGTTAATACCACCGACAAAGAGATGGAGGTGCTTCACTTAAGAAATGTCTCC
TTTGAGGACGCAGGGGAGTATACGTGCTTGGCGGGTAACTCTATCGGACTCTCCCATCAC
TCTGCATGGTTGACCGTTCTGGAAG
gtacacactgtaacttctcctctcgatgtcctgccctcgccacgggcacggggggagcat
gcatttccaggcttggggagacacagaggcaggagagctggaagaatgggctcctgcctg
cctggtgccacatcctgccccagctttgagggctgaatcctctcagctcagagaagagct
EXON 9  203 bp
aatcagggggttgcctgatcctcctagtgccacaatcccagtcctagctagaacttgcca
tggttcttctccctaaaagttcccaggggacaggagacaggtgttgcttttctaatggag
cgggacctcgcatggacggggccctccaagcctgctaacaccctgttcgcactgactcag
CCCTGGAAGAGAGGCCGGCAGTGATGACCTCGCCCCTGTACCTGGAGATCATCATCTATT
GCACAGGGGCCTTCCTCATCTCCTGCATGGTGGGGTCGGTCATCGTCTACAAGATGAAGA
GTGGTACCAAGAAGAGTGACTTCCACAGCCAGATGGCTGTGCACAAGCTGGCCAAGAGCA
TCCCTCTGCGCAGACAGGTAACA
gaaagtagatgggggatttgcacactcagcaccacctctctctctgggcctctaatgccc
tgccctctccattgtccctaatttatagctttgggccttattttctggcttctgggcaag
gcacagtggaatatcatgaactaagtgctctagagtctgtttcaagctagtgtagcccgt
EXON 10  146 bp
tcagtcctagaagttgggcctcctggcctaccatggtctttggaccactctgtgttgagg
aaagaacatcagatacacagacatgtgcctctgccattgttgggaagccctgactaagaa
tgggaaggagtcaccccgtcccccctccttgctctagggtgaccccactcttccttgcag
GTGTCTGCTGACTCCAGTGCATCCATGAACTCTGGGGTTCTTCTGGTTCGGCCATCACGG
CTCTCCTCCAGTGGGACTCCCATGCTAGCAGGGGTCTCTGAGTATGAGCTTCCCGAAGAC
CCTCGCTGGGAGCTGCCTCGGGACAG
gtaataatactttgactcccaactttttgaaggcattccttgcttgctattctagtggtg
gaaggtgtgtatactaacaccttctgggcggtgaaggttcatgaaatgcctgcagaaaca
ttcattccactttctgctcgcagttgggtgaaatacagagaggtggagatggggtgcctc
EXON 11  122 bp
ggtggaaggtgtgtatactaacaccttctgggcggtgaaggttcatgaaatgcctgcaga
aacattcattccactttctgctcgcagttgggtgaaatacagagaggtggagatggggtg
cctctcaaggtttgaacttcaccagccccaacttatgccactctctgtttcccccgaaag
ACTGGTCTTAGGCAAACCCCTGGGAGAGGGCTGCTTTGGGCAGGTGGTGTTGGCAGAGGC
TATCGGGCTGGACAAGGACAAACCCAACCGTGTGACCAAAGTGGCTGTGAAGATGTTGAA
GT
gtaagtgatgcttctgtccttgcaaagaaaatcttgtcccattccaagcaaacagcaggc
ctcgggcccagcagaacagcttctctggtgcctttgctgcccacacctgctccgctgcct
gcttggggttacctgggagtggagggggtgttctgcaccttgagattgttctatgacgtc
EXON 12  111 bp
ctaccacctattgcaacaacggctcccatgagagggaagagaaaacaagtttggatgaag
tggggaggagagaatcaagtcccagggaaaagcagcccctcgacacataccccactccct
tagcctttatcctgccctcctcccttcccaagtaaatgagtctcaacgtgttctttaaag
CGGACGCAACAGAGAAAGACTTGTCAGACCTGATCTCAGAAATGGAGATGATGAAGATGA
TCGGGAAGCATAAGAATATCATCAACCTGCTGGGGGCCTGCACGCAGGATG
gtgggtgccggccagactggctttccctgcccagcggggagaagatctgagctggggtat
cagtcccaaggcctctctcagccacagctagggaagggggttaagagaggctgctttggc
agaggtttaaaatgtgttatctcgggatctgggctccgctcattggtgttcattcaggaa
EXON 13  216 bp
tgggagtaattatttctctgattttttttgggtagtagaatggatttcccaggtccccta
agaggaggcaggagatgggaggttggccggggtgtgctgctgggggtggggtttctttga
ggtgaagccaaacctgctcacctgctgctggccccatggcctcttctcctgtgcctgcag
GTCCCTTGTATGTCATCGTGGAGTATGCCTCCAAGGGCAACCTGCGGGAGTACCTGCAGG
CCCGGAGGCCCCCAGGGCTGGAATACTGCTACAACCCCAGCCACAACCCAGAGGAGCAGC
TCTCCTCCAAGGACCTGGTGTCCTGCGCCTACCAGGTGGCCCGAGGCATGGAGTATCTGG
CCTCCAAGAAGGTGTGGAACCTGAAGGCTCCCCTGG
gtaatgccagggtgggaacagagcccccctagtcttccagcctgtgacttatcatcttgt
ggtggcgttgtggatgcactgagcactggccctgtgtgccctgtgtgttgtcttaggctc
tctgggaactgcagagtcaggagcaccagtgtagccaggtggccttggggtcagactgat
EXON 14  123 bp
gtgatgagaagcctggagctggcagagaatgttagaagagggaaagcaaaggttcggggg
gcagagcagtgtggcagaagttctatgagacaagtcggctagttgcatgggtggcggccg
cccagagccttccagctccctcacctccccgcctcccgctctcccttcctccttcctcag
TGCATACACCGAGACCTGGCAGCCAGGAATGTCCTGGTGACAGAGGACAATGTGATGAAG
ATAGCAGACTTTGGCCTCGCACGGGACATTCACCACATCGACTACTATAAAAAGACAACC
AAC
gtgagtgccgacaaggccgccctgtgctggtggtttcatctgagaagcaaggagtggggt
gggctgagaacccaccccccagtcccttcccacctgtgccctcatggccctgcctggggc
cactccaacctcccctgtgctgctttcagggccgactgcctgtgaagtggatggcacccg
EXON 15  71 bp
ccacatcgactactataaaaagacaaccaacgtgagtgccgacaaggccgccctgtgctg
gtggtttcatctgagaagcaaggagtggggtgggctgagaacccaccccccagtcccttc
ccacctgtgccctcatggccctgcctggggccactccaacctcccctgtgctgctttcag
GGCCGACTGCCTGTGAAGTGGATGGCACCCGAGGCATTATTTGACCGGATCTACACCCAC
CAGAGTGATGT
gtgagtttgtaatagcaattgccagggaggtgtgggatagagagcttctagcactgtaga
gtcctgctttctccctggactgaggagtcctctttctgccccagagagaaaaacaaaaca
ttgtctgtggccattccctctgctccagatgttgaaaggctgatctgttctccatgctgt
EXON 16  138 bp
ctctttctgccccagagagaaaaacaaaacattgtctgtggccattccctctgctccaga
tgttgaaaggctgatctgttctccatgctgtctcctggcactgccctgggtagaggattt
gtgctgggggaggggaggcggagaagctctaacaccctgtggctctccgcccatttgcag
GTGGTCTTTCGGGGTGCTCCTGTGGGAGATCTTCACTCTGGGCGGCTCCCCATACCCCGG
TGTGCCTGTGGAGGAACTTTTCAAGCTGCTGAAGGAGGGTCACCGCATGGACAAGCCCAG
TAACTGCACCAACGAGCT
gtaagcccgaggagatgtcggaggccctgagccaggccttggggcaagagtgggcttgag
gggcagggggctagactagagagtatccatctccaggagacgtccctgaccttacagtcc
tgccgcaggtacatgatgatgcgggactgctggcatgcagtgccctcacagagacccacc
EXON 17  106 bp
tgctgaaggagggtcaccgcatggacaagcccagtaactgcaccaacgagctgtaagccc
gaggagatgtcggaggccctgagccaggccttggggcaagagtgggcttgaggggcaggg
ggctagactagagagtatccatctccaggagacgtccctgaccttacagtcctgccgcag
GTACATGATGATGCGGGACTGCTGGCATGCAGTGCCCTCACAGAGACCCACCTTCAAGCA
GCTGGTGGAAGACCTGGACCGCATCGTGGCCTTGACCTCCAACCAG
gtaaggctgcccgtgccagagccagagctcaggccgtccccactgcgtgcacgcacctcc
ctgagcagggaggaggggcccggcccatcgctgcttcctctcgcccatcacaggagtacc
tggacctgtccatgcccctggaccagtactcccccagctttcccgacacccggagctcta
EXON 18  1031 bp
acagagacccaccttcaagcagctggtggaagacctggaccgcatcgtggccttgacctc
caaccaggtaaggctgcccgtgccagagccagagctcaggccgtccccactgcgtgcacg
cacctccctgagcagggaggaggggcccggcccatcgctgcttcctctcgcccatcacag
GAGTACCTGGACCTGTCCATGCCCCTGGACCAGTACTCCCCCAGCTTTCCCGACACCCGG
AGCTCTACGTGCTCCTCAGGGGAGGATTCCGTCTTCTCTCATGAGCCGCTGCCCGAGGAG
CCCTGCCTGCCCCGACACCCAGCCCAGCTTGCCAATGGCGGACTCAAACGCCGCTGACTG
CCACCCACACGCCCTCCCCAGACTCCACCGTCAGCTGTAACCCTCACCCACAGCCCCTGC
TGGGCCCACCACCTGTCCGTCCCTGTCCCCTTTCCTGCTGGCAGGAGCCGGCTGCCTACC
AGGGGCCTTCCTGTGTGGCCTGCCTTCACCCCACTCAGCTCACCTCTCCCTCCACCTCCT
CTCCACCTGCTGGTGAGAGGTGCAAAGAGGCAGATCTTTGCTGCCAGCCACTTCATCCCC
TCCCAGATGTTGGACCAACACCCCTCCCTGCCACCAGGCACTGCCTGGAGGGCAGGGAGT
GGGAGCCAATGAACAGGCATGCAAGTGAGAGCTTCCTGAGCTTTCTCCTGTCGGTTTGGT
CTGTTTTGCCTTCACCCATAAGCCCCTCGCACTCTGGTGGCAGGTGCCTTGTCCTCAGGG
CTACAGCAGTAGGGAGGTCAGTGCTTCGTGCCTCGATTGAAGGTGACCTCTGCCCCAGAT
AGGTGGTGCCAGTGGCTTATTAATTCCGATACTAGTTTGCTTTGCTGACCAAATGCCTGG
TACCAGAGGATGGTGAGGCGAAGGCCAGGTTGGGGGCAGTGTTGTGGCCCTGGGGCCCAG
CCCCAAACTGGGGGCTCTGTATATAGCTATGAAGAAAACACAAAGTGTATAAATCTGAGT
ATATATTTACATGTCTTTTTAAAAGGGTCGTTACCAGAGATTTACCCATCGGGTAAGATG
CTCCTGGTGGCTGGGAGGCATCAGTTGCTATATATTAAAAACAAAAAAGAAAAAAAAGGA
AAATGTTTTTAAAAAGGTCATATATTTTTTGCTACTTTTGCTGTTTTATTTTTTTAAATT
ATGTTCTAAAC
ctattttcagtttaggtccctcaataaaaattgctgctgcttcatttatctatgggctgt
atgaaaagggtgggaatgtccactggaaagaagggacacccacgggccctggggctaggt
ctgtcccgagggcaccgcatgctcccggcgcaggttccttgtaacctcttcttcctaggt