Gene FGF17 Variant 1
DNA : 5.33 KbNT_023666
mRNA : 663 bp NM_003867
CDS : 651 bp NP_003858
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  47 bp
ttacgccctcctcctccccctcctcctccctcttttctctcctcctcctcccctttctct
cctcctcgcccccctgaaaacctgtggctcggagagaccttggcttctctgggactctac
ccctggggacttcccacatctgctcctgagcttgggggcaggggggcaaccgcctgagga
ACCTCTCCAGCGATGGGAGCCGCCCGCCTGCTGCCCAACCTCACTCT
gtaagtgtgctacctctcccactggagtttcgttgccatttccagcctcagggcagccct
cctcttcccgggactcccacgcgtgcgtgcacggggctggcagggcgggggcgggggcct
gggtgcaccctaggcttgcagctggcacccacacctgggcttacctcctctccccacaca
EXON 2  37 bp
taagtgtgctacctctcccactggagtttcgttgccatttccagcctcagggcagccctc
ctcttcccgggactcccacgcgtgcgtgcacggggctggcagggcgggggcgggggcctg
ggtgcaccctaggcttgcagctggcacccacacctgggcttacctcctctccccacacag
GTGCTTACAGCTGCTGATTCTCTGCTGTCAAACTCAG
gtaggcgggcattcccaccggctttcccccaatttttccaccctacctgaccagggcggg
tgcaagggaccggctcctttcaggtggacagaggcagagtctggcctctccctgggtcca
ggaggcactgaggtttggaggggagtgagcctttgaccgggtgggcagggaagggggctg
EXON 3  178 bp
agaggttatgaccggctcacccaggggcctgggaaggctatggccatatgcccacttcac
tctgcaggacaagtggcctgtccccactatattcacctcctcacccctctcccttggatg
gaccagtggtggtgtcacccaaagcaaattgacactatttttcccttggtaaccgcaaag
GGGGAGAATCACCCGTCTCCTAATTTTAACCAGTACGTGAGGGACCAGGGCGCCATGACC
GACCAGCTGAGCAGGCGGCAGATCCGCGAGTACCAACTCTACAGCAGGACCAGTGGCAAG
CACGTGCAGGTCACCGGGCGTCGCATCTCCGCCACCGCCGAGGACGGCAACAAGTTTG
gtgagagttggccctccccccagggcacccacacctccactctgcctcacttccaccctg
cctcacctcctggtccatccccagatcctgtgtcagggctgagggccccaagggcctgag
tgtccccaaccccttcgcctgagtctggaggtcagtgtggctgggtggtcccctgctgta
EXON 4  107 bp
ccctgcctcacctcctggtccatccccagatcctgtgtcagggctgagggccccaagggc
ctgagtgtccccaaccccttcgcctgagtctggaggtcagtgtggctgggtggtcccctg
ctgtagccataggccggcagccccgatggacggaggtctttctcccctcccccaccacag
CCAAGCTCATAGTGGAGACGGACACGTTTGGCAGCCGGGTTCGCATCAAAGGGGCTGAGA
GTGAGAAGTACATCTGTATGAACAAGAGGGGCAAGCTCATCGGGAAG
gtgaggctgggagactgggaagtaacagagaatcagccctactggggtggggacatatag
ggcatcatgctcccctctctcctctgagccacacaccctcctgtgtaaagacttcccatc
ctactctcagcccacccactgggccactctctggtttttattttagagtccgggtcttgc
EXON 5  294 bp
ttcttgttggccactgttgcctctctaaataggatgccatctcaccaggcagagttccct
gggctcacggccccgttgttcccgttgtccctcctcagtcgtccaaaataggccgtaagg
gcgacaccccagaccagggtaggtggacaaatgcccttcctgtccttgcttctcccgcag
CCCAGCGGGAAGAGCAAAGACTGCGTGTTCACGGAGATCGTGCTGGAGAACAACTATACG
GCCTTCCAGAACGCCCGGCACGAGGGCTGGTTCATGGCCTTCACGCGGCAGGGGCGGCCC
CGCCAGGCTTCCCGCAGCCGCCAGAACCAGCGCGAGGCCCACTTCATCAAGCGCCTCTAC
CAAGGCCAGCTGCCCTTCCCCAACCACGCCGAGAAGCAGAAGCAGTTCGAGTTTGTGGGC
TCCGCCCCCACCCGCCGGACCAAGCGCACACGGCGGCCCCAGCCCCTCACGTAG
tctgggaggcagggggcagcagcccctgggccgcctccccacccctttcccttcttaatc
caaggactgggctggggtggcgggaggggagccagatccccgagggaggaccctgagggc
cgcgaagcatccgagcccccagctgggaaggggcaggccggtgccccaggggcggctggc