Gene FBXO25 Variant 1
DNA : 55.98 KbNT_023736
mRNA : 1284 bp NM_012173
CDS : 876 bp NP_036305
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  141 bp
atcactttagtacacagtactgtgttattgtcactgtcaccaatgtcgagccaacgttta
attaatgagcagacatttaaatgttaagaactttaatctttaaaattaataaatgttcta
agtgaaaagaaacttttatgaattatatatactttttaacataatttaactttttcatag
GAGAACTATGCCATTTTTGGGTCAGGACTGGAGATCTCCTGGATGGAGTTGGATTAAGAC
AGAAGATGGCTGGAAGAGATGTGAATCTTGTAGTCAGAAACTTGAAAGAGAGAATAACCG
TTGTAACATCAGTCACAGCAT
gtaagttacagctgagcagaaccatgccatttgccagtttagcatgtatggccttaccta
tttttcaagtccctgcaaagctccataacttttgagacttgcccacccagaaggctggtg
tgaagagacaagttgtttagctaaaaaatgaggctagtagattgcctaatattcatacac
EXON 2  104 bp
ttctcaaagaaccaggatacatcttatttctcaaaatgaaacaaaaatgtattagacatt
acccttgtgatttcaagcccacagtctgtcactttgaagtatttatatccttttacaaaa
gaaaagccaaatgaagatctccctgaaaaaatattttaatagaatgtgtctttatttcag
TATCTTAAATAGTGAAGATGGAGAAATATTCAATAATGAAGAGCATGAATATGCATCGAA
AAAAAGGAAAAAGGACCATTTTAGAAATGACACAAATACTCAAA
gtaagatcattctcattaattttattttacttgttgattacgttgaaatactaaattact
ctgacaatgctatcttatgaaataaaaggtgatacaaatatgtaaataacagcccagtat
ccagcattgcctacagatttagtgatcaaactttttgcagctcaaccgtttcagtgggta
EXON 3  93 bp
gcttaaattattagcattgctataattttactatactctcatctaaatctaaaatcagtc
ttcaaaataaaaacaaattgtcctttgccaaaaatttttttaatcgcacaattaattgac
attaactgccaattctttttggctaattgactaattttaacttctgtgttgcttttccag
AGGCATGGCTATTGCACCTTGGGAGAAGCCTTTAATCGGTTAGACTTCTCAAGTGCAATT
CAAGATATCCGAAGGTTCAATTATGTGGTCAAA
gtaagtgttctatttcaaaaactactttgatgactcttttgaacaactatattttgaaga
ttgtaagtgtacaacgttgaagatgcttttggcagcttgaaggtgtgcctgtttgctgcg
tattaatcaaaaaacagaagggaacaagttcaggagaaaacagtgaggttggaggatttc
EXON 4  94 bp
aaggtctcttcaggtttgcatgggtagtgactgtttcctatacttggactcggactgata
cagtgacttaatttaggatggcatgttagaaatcttcatgcatgtgtgttatatcactgt
ggtttgtaattccatattaaatatatatatcgctcagcttttttccgtctttcctttaag
CTGTTGCAGCTAATTGCAAAATCCCAGTTAACTTCATTGAGTGGCGTGGCACAGAAGAAT
TACTTCAACATTTTGGATAAAATCGTTCAAAAGG
gtaagatgatcactgtatttttaatactctaaatcttaattagaaatttggtgcaaggag
atgggatttttcttttatctttacccagtacacatactgtcaaaaacaattgtgtaaata
atgtgataacatcagaaatacaggtcatccttccagttcccagtgttctgttactgccgt
EXON 5  185 bp
tgctgaatatgtgtgagaatttccctcctttttagggctgaataatattctattgcatgt
atagatcacacgttgtttgtctgttcgtctatcagtggacatttgggttatgaaactaga
tctttttttaaagtgttgcttaactgtatcaatccatagttttatttttatttattccag
TTCTTGATGACCACCACAATCCTCGCTTAATCAAAGATCTTCTGCAAGACCTAAGCTCTA
CCCTCTGCATTCTTATTAGAGGAGTAGGGAAGTCTGTATTAGTGGGAAACATCAATATTT
GGATTTGCCGATTAGAAACTATTCTCGCCTGGCAACAACAGCTACAGGATCTTCAGATGA
CTAAG
gtataaatatctcggcataagagttattacactctgtttttatattacagaagttatctt
ttctaagcatacatgaaagactgctatagctttttgaaagattttctaatgctttcataa
gtattcattaaattgttttaaaatagaaaaggaccaaagaccccaatggcttatagttgc
EXON 6  183 bp
tcctccagccttccccacggtggtggatgcaggccccttgacaccttgcgacgcatgaca
tggagagctctttttgtgttaccatgttttgaagcattcattccagcttgactcttcagt
tactgtgtgaacaaacattggccatcttctcagtgagttgctgttgtgttttcctttcag
CAAGTGAACAATGGCCTCACCCTCAGTGACCTTCCTCTGCACATGCTGAACAACATCCTA
TACCGGTTCTCAGACGGATGGGACATCATCACCTTAGGCCAGGTGACCCCCACGTTGTAT
ATGCTTAGTGAAGACAGACAGCTGTGGAAGAAGCTTTGTCAGTACCATTTTGCTGAAAAG
CAG
gtgagtgggatgcagcagtctcccctcaggctgggagtttatagactctgcctgggggcc
ataccctataaactcacctggagagaaagaatggctgagtattttctacttttaaagaac
caggaacaatcagagtttattgagattgctgtgggttctctcctatagaatgtaaggttt
EXON 7  144 bp
aatcccagacttcagcactgtacaattcatccatgtaaccaaaacccacttgtaacccta
aagctattgaagtttaaaaaaagaaattaaaaactaaaataaaatgaaaaagttttacac
ctaatattatgttttgaaagtcatcttatgcggattctgaatggagttttgtttgtttag
TTTTGTAGACATTTGATCCTTTCAGAAAAAGGTCATATTGAATGGAAGTTGATGTACTTT
GCACTTCAGAAACATTACCCAGCGAAGGAGCAGTACGGAGACACACTGCATTTCTGTCGG
CACTGCAGCATTCTCTTTTGGAAG
gtactgatttaaatgcactcttggaatttcaggattaaattttggtgaaacaaactaatc
acctatattttaagtataagactaaaaagcggaaaatactgtttgttataagtaagttaa
ggagatatattttaccaaatattggggtaggggaacagatgttcattcaatgtgtagctt
EXON 8  340 bp
tatgtagaatcggctgcggctgcccttgtgttggtcattctcatccaagttatctcccat
gtacctctgaggtggggcccagggtccacatcaacaagcagctgacgacccctcaagcac
catcactagagtgtggctggtggtggggccccctcctaaccatctcccacctccccacag
GACTCAGGACACCCCTGCACGGCGGCCGACCCTGACAGCTGCTTCACGCCTGTGTCTCCG
CAGCACTTCATCGACCTCTTCAAGTTTTAAGGGCTGCCCCTGCCATCCCTATTGGAGATT
GTGAATCCTGCTGTCTGTGCAGGGCTCATAGTGAGTGTTCTGTGAGGTGGGTGGAGACTC
CTCGGAAGCCCCTGCTTCCAGAAAGCCTGGGAAGAACTGCCCTTCTGCAAAGGGGGGACT
GCATGGTTGCATTTTCATCACTGAAAGTCAGAGGCCAAGGAAATCATTTCTACTTCTTTA
AAAACTCCTTCTAAGCATATTAAAATGTGAAATTTTGCGT
actctctctctctatatatatagttcaaaaatactttaggtggtcagctccacattcttt
gttgacgtgacactaacggccaataatatgcttcttaattatcaaattatagtttcccaa
ttgggaaactaattgggggtgggttacaaaacatttgatccttgtaaatacattgtacag