Gene ELP3 Variant 1
DNA : 97.94 KbNT_023666
mRNA : 3075 bp NM_018091
CDS : 1644 bp NP_060561
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  25 bp
taccctgttagttgcaacacggggcggggcgtggctttgtgcacgtcggcttccgggaag
agctttacgatacattgaccgacattttacgacaggcgggattgttttgtggctgtcagc
tttccccgtggtctgagtttgtggctgcatttttatctctggtggctctgctacggcggc
GCAGAAATGAGGCAGAAGCGGAAAG
gtgcgaaaggggaaggagatgggggaaaggggtggtccgaaaggggcgaacgcccaggca
atcaaatgctgaaccgaacttttaccgcgagaatccgctacccagtccagtcgccccgcc
acctagggtcagtgtgtccattctggtccccgagccttctcgtttttcctgttttgcttt
EXON 2  100 bp
gttttaaagatacaaaagatatgatcaaattgtaaacagtagagatttagcatcttctga
acttgagctattcatttggcatatttgtatggtttcggatggaaaactgctactaaatca
gattttaaaatcttgattgaatgatacgatttttgacattgttgaatattaactttccag
GAGATCTCAGCCCTGCTGAGCTGATGATGCTGACTATAGGAGATGTTATTAAACAACTGA
TTGAAGCCCACGAGCAGGGGAAAGACATCGATCTAAATAA
gtaagtggatataaagagagagcaagcttgttcttaggtagcagatctcttttatgaaat
tatctagtactacttgttttccagctcaagttttattttagttgagaattttagctttct
gccttgccttgtcattcatttctttttttttttttgcaagttccgcctctggggttaacg
EXON 3  139 bp
ttcactcgtgaattttattcttctatttccctgatagtcacagatcttaaaactatcctt
gtcacgtggtgaagggattggagagtgacagttgttaatgatgttgtttatagatcatcc
tcttggtagcttgtccttaaataaccgtaatcttgataatgtgagatgctttactttcag
GGTGAAAACCAAGACAGCTGCCAAATATGGCCTTTCTGCCCAGCCCCGCCTGGTGGATAT
CATTGCTGCCGTCCCTCCTCAGTATCGCAAGGTCTTGATGCCCAAGTTAAAGGCGAAACC
CATCAGAACTGCTAGTGGG
gtgagtgattcgactcatgaggtatcgacacactgggtatctgttctggcagaagtccct
gctccatgtgacgcccgtgtagtgaggtagaggttggggattctgaactaatgaagtccc
tgtattaggatatgtgctggagtggagacctgtgctgaatgcaaggagagcagagagaga
EXON 4  71 bp
ccgtctcaaaaaaaaaaaaaaaaaaaaaaaaaaaagaaatacagcctcgtcaataccttt
gaagcccctttttgccactctctggttgcattcctctccttccttccgagggataagcac
tctgtggagttttatattaattatcctataatagcttttttattcatctttcttttatag
ATTGCTGTCGTGGCTGTGATGTGCAAACCCCACAGATGTCCACACATCAGTTTTACAGGA
AATATATGTGT
gtaagtatggtgattttattaaattgtatgtatgttttaattaagctaaatatgccccct
ctagcccttagtcagtacatcctggtaatgtttaaaacttcagcttaatagatttataga
ttactcctttcaaacaagcaaccattggtagatattttagtgctttaaaattggaatata
EXON 5  64 bp
tatttacttcttggtagaaaatacattatttacagatactgcaaaggtagattcttctgt
taggatttgaaaaggaagctcatttgttatcaggattctttggagatggtagatgcttgg
aactagctgattgaactcagttttgcatctgacattcttgttcttttgttgtactggcag
ATACTGCCCTGGTGGACCTGATTCTGATTTTGAGTATTCCACCCAGTCTTACACTGGCTA
TGAG
gtacagtaactttgaggctgtcctgatgaaatgttgcatcatgctttacctgtagtatgg
ttttaccagtactggctttctgacaattttttgtttttgtttttgtttttttctgatttt
aaaagctgttcattcaccaaatatttgccagtgtctactagtgccctatattattctagc
EXON 6  69 bp
ctgccagatgcgattcaggacattattttgaaccctgacaagactgagaaaaattaatgc
gggtacaagccacgttttcagtgttcggaaccatggagagttttttttaaaatacagtcc
ttttgaaactactttttagttttaattcaatgtgggcataacaatatttttctcttctag
CCAACCTCCATGAGAGCTATCCGTGCCAGATATGACCCTTTCCTACAGACAAGACACCGA
ATAGAACAG
gtacatttttaaaaaacatgtttcttaaaaattaggtgtttatacttagtaagaagccat
tgttgcttgattcaaattgaacctgaaataagaatgaaaaaggtgtttttcctctttgta
agttttcaatatccatttgagggagggagaatttgccatgcctagcaaggtcaaaaacac
EXON 7  155 bp
cacttttttctttcagacttgggcctattttttatccacagaattagctaagtgtgtttc
attacttctgatttttaaactgtactgatgaaaacactgcaaaataagagatttgcaatg
ccttcttagagtagttccttatgcttatatcattctaatgctgatgaatttgtctttcag
TTAAAACAACTTGGTCATAGTGTGGATAAAGTGGAGTTTATTGTGATGGGTGGAACGTTT
ATGGCCCTTCCAGAAGAATACAGAGATTATTTTATTCGAAATTTACATGATGCCTTATCA
GGACATACTTCCAACAATATTTACGAGGCAGTCAA
gtaagaaattcttattttatcatagtctccagagtggttgtcagtttatgctcctagcag
tagtctacgagaatgccttctgccctgcatccacattcttacttctcataatctttcttg
tttcatgggaaaggattatttcagtgaaaataatgctttcgctgaaataatcttttccag
EXON 8  162 bp
atccccatgtgcatagttaggaagtagcagagccaggatttgaactcaggcagcctggct
ccagagcctacactctttaccactatctcatactaggaggacagagagaaggcagttttt
tgagacagagtaatgtcttaaaacctgcaacaggttaattattttagatttgctctacag
GTATTCTGAGAGAAGCCTCACAAAGTGTATTGGAATTACTATTGAAACCAGACCAGATTA
CTGCATGAAGCGACATTTAAGTGACATGTTGACCTATGGCTGCACAAGGCTGGAGATTGG
GGTGCAGAGTGTTTATGAAGATGTGGCTAGAGACACCAACAG
gtaagatggtggcaggtgatcttgcacaagtcttcctccaagttcaccattttctctaca
ttcatacccagcctttcttccttctgaccactcttagggaaagaagtatgggtattcctc
cttttcagagttctttcttctgtctgtgttcttaattccatcccctctttccctcatttt
EXON 9  127 bp
atgactttctgagatgtcttttcccccagccatatgattttggttatggaacttctgtta
cctgtctcagagattgttttccccttgttccttgtgttaactttgtcacccatttatttg
tgtaacagatgttacacaaataggtagtgattttcacaggtagtgattttctttccttag
GGGCCACACTGTGAAGGCAGTGTGTGAGTCATTTCACCTGGCCAAAGATTCCGGTTTTAA
AGTGGTGGCCCATATGATGCCTGACCTGCCAAACGTGGGACTAGAAAGAGACATTGAACA
GTTCACA
gtaagtgtgacttcagccaggcgcattcagaatggctctgcatgtttcttatcccatctg
gtcttgttgcttgttcactgttgatgttttccagtgttaaagaaatgcatccttattata
gaatattagaaacacagtagggtaagagacatcacccatagccccatcagacaaaactct
EXON 10  194 bp
ccccagtgagactacagaaacaaggagtttctgttctgtctgtacgccctacctggtcag
aagcaaaggctgccccagggcctactgggtgtgccagagaagctgtcaggggttgagatt
tcaccctcggtgatctctgcataactaatggagaagtcattttctgttctctattcacag
GAGTTTTTTGAGAACCCTGCTTTTCGTCCCGATGGGCTGAAACTCTATCCTACCCTGGTG
ATTCGTGGGACCGGGCTTTATGAGCTTTGGAAATCAGGAAGATATAAGAGTTACTCTCCT
AGTGACCTGGTTGAATTGGTGGCTCGGATCCTAGCCCTCGTGCCTCCATGGACTCGAGTG
TACCGAGTACAGAG
gtagtgtgttatcttttattcctaaaatagttggtgactagtctgtttactatttctcat
ggaaatagtctgatttcatattgagggttttggatttttcttaatggaaataagataact
ggaatgctatctgtaaatagggagggatggaaatcatagcatgtctaagccactttgcca
EXON 11  91 bp
agaaagctgaggcatagagaagctccttgttaggaggctttgcctctgatttcctggtca
gcttcataggttttttgcttttttatttttgttctttttaacttttttaatatccttgcc
ttactgctgtggagaatgatttctattttgcaacagcttatgtttttctcctgtgtacag
GGATATTCCAATGCCTTTAGTTAGCTCAGGAGTAGAGCATGGTAACCTGAGAGAGCTGGC
ACTTGCAAGAATGAAAGACCTCGGAATACAG
gtaagagcaaatatggcggtcaggccacaactgttgagaaaaagagaaatctgaaacacg
aaagactttgccactaccacccctaaaaccagacttgcgggtcaggtcagaaagctccca
gatgttgaaagcatagtcactgaactgtgtcggagctgaagccagtggtgcaggggctgc
EXON 12  66 bp
aaggtggttttattttgaaattcagctcttttatctcactgcaagttatatgcaaactta
attttgagcccagggtttggtggagaggtttaaataaaaataaagattgaattggttacc
agttttatatttgtacccctcccaccccccaaccccgctcacgccatttttttttgacag
TGTCGAGATGTGAGAACCAGAGAAGTTGGAATCCAAGAAATTCATCACAAAGTACGGCCA
TACCAG
gttagtctcttcatgtcatagagggcctaggtactgtccttagatctttgccaaccctgg
gcccacatattcttaaccaaggacagagccccaggagtgaataactaagagcagagacta
atcgaggattagataccggtgtcaaaccgtgaaagccaaatacaagaattctagaagagc
EXON 13  228 bp
caaggtgtgaactttaatcttggtgctatttgagagtagacaagtaaaaagaaacataat
tagtgattattcattccttatccctaactagatattaacctaaataaatacatacaatta
caaaaatgaatttggttctttaattttgaataatattttttgtggctttttactaaatag
GTTGAATTGGTAAGGAGAGATTATGTTGCAAATGGTGGCTGGGAAACATTCTTGTCATAC
GAAGACCCAGATCAAGACATTTTGATTGGCCTCCTACGATTACGCAAGTGTTCAGAAGAA
ACTTTCCGTTTCGAATTGGGTGGAGGTGTCTCCATAGTACGAGAGCTGCATGTGTATGGG
AGTGTGGTCCCTGTGAGCAGCCGGGATCCTACTAAATTTCAGCATCAG
gtatcctgtattccatttctatttgacttctaagaaactgcctaagtaggaaaagagaaa
aggaatggggtgaagagaagaggaagaggcagaggagcaggagaggggaaagagaagcat
agaaacagaggagccagtgttttagttgttcagagatgttttctctccaaattgtatcct
EXON 14  82 bp
tgctacagtgtacctttggtaggattgaatggtttctttttccttactcccataagtggg
ctttttcactcttaacagattttagcaactactaaagtatatagccttcttgttttatgg
acccctcttaatgaacttccttcctttttaattcccactccccattgttgctccgtgcag
GGATTTGGCATGCTGCTGATGGAGGAAGCAGAAAGAATAGCTAGAGAAGAACATGGGTCT
GGGAAAATCGCTGTGATATCAG
gtaactgggggagggcgaagttcatgattccttcccattttgaacttggcaccacagtga
aaactatgttggtaccctcttgcccctgttgatggttattacgttcaaaattgagctgag
ctgactggcgaaggacttgtgctcaaacaaaattcacaaaagcagtttagtggaatagag
EXON 15  1502 bp
ctatattttaatgcagcctgaattcaaagtaataatgttccaaacttattaagctgagat
tttatgtgggagagaatttggtctctgggtgggagagagtgtaaggctgagggaagcaca
tgccgacttttgagaattgctaaagtgaatgctccttttttaacttcgatttttctgcag
GGGTCGGCACCAGGAATTATTATAGAAAGATCGGCTACAGATTACAAGGCCCGTACATGG
TGAAGATGCTGAAATAATGGCCACACCAGTCCACTCTTCTGCAGTATCCTCCCTGGCAGA
ACACGGAGAATCAGGATTTCTTAAATACTCAACAGAGAGGCTGAGCAGAGCAAATGGGGG
GCTTCACCCTCATCCCGCAGCTGCAGAGACTGGAAACTGCCTTCAAGGCCACGGCTGGTC
ATCTGCTGACCACACCCCAGATCCGCCCTCTCCTGCGTGCACCCCAAAAAATCACTTGCG
TTTTTGAGGCTTAAATCATCTATCCAGTTTCTACATTTTGCATGAGGCCTGCAGGTGGCC
TATTTTGACTCAGACGGTGAAAAAAGCAAATTAACTCATTTGGACACCATAACTCATGCA
ATAAAACTGATTGTCATTCGAGGAGCAAACTTAAGAGTAGTTTATTTATATACCCTGGGG
ACAGAAAGTCAGGTTGAAACAGGAAAACCACCAGACTCTAATCTCAGCCCTTTAACGACA
TACGCATTGGAGCGCAAGTTAGGAAAATGAGCTTTTGTTTTCATGGAAATCATTCTGATT
ACAGTGCTGATGTTTAGAAATAAATAGCAGTGTGACTGGGAAAGAGGAATTGCAGTTGTG
GGGGTGTGAGCCTGGCAGCAGCCAGCCAGCAGCCTCTCCCAGGCGGGAGTCTACCATCCG
AGACGGCGATGACAAAGAGCTTCATTCCACATTCTTTGTTATCTCTACTTCCCACCCTCT
TGGCAACTACAGAGCAGTGTGGGCAGCCCCAAGTGTGGTCCCCAGAGAGCGTTTGGCTTT
CCTGTCTGTCTATCCTGAGCGGGTGGAGTCTCAGGTTGTGTGCCCCTAAATCAAGATTTG
CTTCCACAGAAGCCATTACTTGCAATTTTTTTTTTTTTTCTGAGAAAGTCTCGCTGTGTC
ACCCAGGCTGGAGTGCAGTGGCGCAATCTCACTGCATCCTCCGCCTCCCGGGTTCAAGCG
ATTCTCCCGCCTCAGCCTCCTGAGTAGCTGGGATTACAGGCACCCGCCGCTGCTAATTTT
TGTATTTTTAGTAGAGATGGGGGTTTCACCATATTGGTCAGGCTGGTCTCGAACTCCTGA
CCTCAGGTGATCAACCCACCTTGGCCTCCCTAAATGCCGGGATTACAGGCATGAGCCACC
GCTCCCAGCCTTTGATTTTTTAAGGTGGATTTTGGTTGTTATAAATGGAGAAAGGTAAGA
GTTCAAGTTCAACCCGTGTGTGAAAGCAAAACAATGGAAAACAGGATTGGCTTCTTCAAA
GGCTCCTCTTGTAGAACTGCCTCTTTGAAATTTCGAGGTAATCTACTTTGGAGACTCTGC
CTGGAGAGGGTCAGTTCCTAAGTTAAAAGCATCGCTTAACCTTGGCTCCTGTGGCATTTT
ACAAAGGTTTAAAGGAATTGATTCCTCTGAAAGGGCCTGAAAATAAAAAGTCTTTAACAT
AC
aaagaagagtcatgtggttttctttctctccctgtaaatgcagtgacatttgccacaaat
gtgcaggtttcagtttccaacctatggcactgttcatttcctcccgggtgctgtttgcca
tttcattaaactgctatgaggcaaatggcagtggctttgttatgggctggctgtggaacc