Gene DOK2 Variant 1
DNA : 4.29 KbNT_023666
mRNA : 1239 bp NM_003974
CDS : 1239 bp NP_003965
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  63 bp
actcagaagaaaccgcagggcctatcagcctgtcgtcatcgagcagactagaatagtata
gaaaaccctaggcagagaggaaatgaacttcagagaagggaaacacacggctaagaagag
agaggcaagggcaggagtgaaggagagagctgaagcctggggctccgagatggtcagagg
ATGGGAGACGGGGCAGTGAAACAAGGCTTCTTGTATCTTCAGCAGCAGCAGACGTTTGGA
AAG
gtaggagtgaggctgggctggggttgggcagggggcctgggaggctgctagaattcctgg
gttggagagggagtttcatattcaaaacccttataggtctgactgtgcacccaccaagtt
agacccagagctcaactttgggagggctcttttcctacccgacgctgtctcctgaaccag
EXON 2  282 bp
cctgcagtcactgtcctcttctctgcctccctgggtctcatgtgatcttcacctctctct
ccccatctccaagtggctgccccagtccccctcccacggttcctcttctccccttggctc
acgatctccccgtctctgggtggctccctcccgcccccgcctcccacgcctctggcacag
AAATGGCGCCGCTTCGGCGCCTCACTGTATGGAGGGTCGGACTGCGCCTTGGCCCGGCTG
GAGCTGCAGGAGGGCCCGGAGAAGCCTCGTCGGTGTGAGGCTGCCCGGAAGGTCATCCGC
CTCAGTGACTGCCTGCGGGTGGCCGAGGCCGGCGGAGAGGCCAGCAGCCCCCGGGACACC
AGTGCCTTCTTCCTGGAGACCAAGGAGCGCCTGTACCTCCTGGCGGCCCCTGCAGCGGAG
CGCGGCGACTGGGTGCAGGCCATCTGCCTCCTGGCCTTCCCC
gtgagtcgcgcggggtgcggaaagggcaagggggcgtgcaggccgagggtgttagatact
tcctgtgggcaagtgttacaggtgtcaaggtcagggtgatggggtgcttcctccatgtgg
ggggacccgaacccagtgtgcagacagagccagcaggttgaggtggcctgaaagaaggcc
EXON 3  88 bp
tcctgtgggcaagtgttacaggtgtcaaggtcagggtgatggggtgcttcctccatgtgg
ggggacccgaacccagtgtgcagacagagccagcaggttgaggtggcctgaaagaaggcc
tgggccagaggggggcctggggatcggggaaggtgatgagacggggcgcctcctccctag
GGGCAGAGGAAGGAGCTCTCGGGGCCAGAGGGAAAGCAGAGCCGGCCCTGCATGGAGGAA
AATGAATTGTACAGCAGCGCAGTCACAG
gtgagggggcgggggctgccctgctctcccctgggggctctccccagggtgaggtggaga
ggaggtgtgggctggctagctgctggccccgagtcttcctgccttgtggttatccccagc
ctgggccagccccgttatcagcctctccttctcgcttccgggtgcagcccaacgtaggga
EXON 4  185 bp
ttggggagtatgacctggcacagagcagctcagcctccaagacccaggcagggggccata
agtgtgtggataatactttctagaaaagttctggtacgctcatttagaactgggcagtgg
tgaggcaggccagctgtttcccattaactgccttcgccttctctctcttcttctccccag
TCGGCCCCCACAAGGAATTTGCTGTGACCATGAGACCTACAGAAGCCAGTGAGAGGTGCC
ACCTGCGGGGGTCCTATACCCTCCGGGCTGGGGAGAGTGCCCTGGAGCTGTGGGGTGGGC
CCGAGCCAGGGACCCAGCTGTACGACTGGCCCTACAGGTTTCTGCGGCGCTTTGGGCGGG
ACAAG
gtgagtgggaagctgcatcagggcaggttgagagaaaggataagctacgaacaaagaggg
gtgagaagcagcgaggggatgggagagaccaggagagggagatggagtgaagcaaagaat
agagtgacaagatggcagaagtggagtagaaggaaggagaatgagaagaggtggagagac
EXON 5  621 bp
taccagggaggctgaggcaggagaatcgcttgaacctgggaggcggaggttgcagtgagc
tgagattgtgccactgcactccagcctggagacacagtgagactctgtctccaaaaaaaa
aaaaaaaaatgcacccctgccctgtggcctggccaataacctgctttctccctggtccag
GTAACCTTTTCCTTTGAGGCAGGCCGTCGCTGCGTCTCTGGAGAGGGCAACTTTGAGTTC
GAAACCCGGCAAGGCAATGAGATCTTCTTGGCCCTGGAAGAGGCCATCTCTGCCCAGAAG
AATGCTGCACCCGCTACACCCCAACCGCAGCCAGCCACAATCCCCGCGTCGCTGCCCCGG
CCTGATAGCCCCTACTCTCGGCCGCATGACTCACTGCCGCCGCCTTCACCCACCACACCG
GTGCCTGCTCCACGGCCTCGGGGCCAGGAGGGGGAGTATGCCGTGCCCTTCGATGCGGTG
GCCCGTTCCTTGGGGAAGAACTTCAGGGGCATCTTGGCAGTCCCTCCTCAGCTCCTGGCC
GACCCTCTGTACGACAGCATTGAGGAGACCCTGCCCCCTCGACCTGACCACATATACGAT
GAGCCCGAGGGAGTGGCTGCCCTGTCCCTCTATGACAGCCCGCAGGAGCCCCGGGGTGAG
GCATGGAGGAGGCAGGCGACAGCTGACAGGGACCCTGCTGGCCTCCAGCATGTCCAGCCA
GCCGGGCAGGATTTCTCTGCTTCTGGCTGGCAGCCAGGAACTGAGTATGACAATGTTGTA
CTAAAGAAAGGCCCAAAGTGA
cagaggcagcagagggatggtccaccgccccttggcttctgctggtgactcctcctggcc
actgcatcagaagaacctcctctgccccttctggagcccgaggcctggcctgtcttcgtt
ggggctgataaattgcctctcccagggcctgctgggtgagtcaccatcccaaagcaggaa