Gene DEFA1 Variant 1
DNA : 2.42 KbNT_023736
mRNA : 486 bp NM_004084
CDS : 285 bp NP_004075
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  68 bp
tagatgagaggttcctctgtggagttctactttaacctcaccttcccaccaaatttctca
actgtccttgccaccacaattatttaatggacccaacagaaagtaaccccggaaattagg
acacctcatcccaaaagacctttaaataggggaagtccacttgtgcacggctgctccttg
CTATAGAAGACCTGGGACAGAGGACTGCTGTCTGCCCTCTCTGGTCACCCTGCCTAGCTA
GAGGATCT
gtaagtactacaaaacttaaactttacactgagttttcattattgaagctatgcctccaa
tctgacctctgactgtggggccaccccagagggaaccagcgggcgaatccctgctaggaa
cgtctgtccggacctctggtgactgctggggacgatggcttccagctaacttaatagaga
EXON 2  187 bp
actgggagaacaggagcattcgagcaaccttgagaccaatgggcctctcttataaaatgc
acacctcctctcactgagattgaggaaggtttcttgtctccgagccttctcccagtagag
ctataaatccaggctggctcctccctccccacacagctgctcctgctctccctcctccag
GTGACCCCAGCCATGAGGACCCTCGCCATCCTTGCTGCCATTCTCCTGGTGGCCCTGCAG
GCCCAGGCTGAGCCACTCCAGGCAAGAGCTGATGAGGTTGCTGCAGCCCCGGAGCAGATT
GCAGCGGACATCCCAGAAGTGGTTGTTTCCCTTGCATGGGACGAAAGCTTGGCTCCAAAG
CATCCAG
gtgagagaggcaggcatgcagagctgctaagtctagagggaaggacgggagagaggttcc
agagttgggtctcagcagtctatgtcactgaggtggcttcacttagaatctctgggcatt
gattttctcatctagaaattgaacagagagccaaataaacatgagaaactttatttctcc
EXON 3  231 bp
tctcaaattctgagtgacaagcactgctctgcgtgtttattcctatcgactgaggttgtt
cgtgctaacggctgcaatgcagccagcatcacctgtcagctagcatgtgacttccccgag
attctttttcttacccactgctaactccatactcaatttctcatgctctccctgtcccag
GCTCAAGGAAAAACATGGCCTGCTATTGCAGAATACCAGCGTGCATTGCAGGAGAACGTC
GCTATGGAACCTGCATCTACCAGGGAAGACTCTGGGCATTCTGCTGCTGAGCTTGCAGAA
AAAGAAAAATGAGCTCAAAATTTGCTTTGAGAGCTACAGGGAATTGCTATTACTCCTGTA
CCTTCTGCTCAATTTCCTTTCCTCATCCCAAATAAATGCCTTGTTACAAGA
tttctgtgtttccacctctttaatgtgtgatatgtgtctgtgtcaagacacttgggatac
acgtaccaaaacgcaaaatcaaatttttgaacaatataaaattccaaattctaggaattt
caagcaggagtttgggcttcagatccaaattgaaaagaaggcccatatgacaccactgat