Gene CYP11B2 Variant 1
DNA : 7.28 KbNT_008127
mRNA : 2936 bp NM_000498
CDS : 1512 bp NP_000489
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  242 bp
ggggaattaggcacctgacttctccttcatctacctttggctgggggcctccagccttga
ccttcgctctgagagtctcaggcaggtccagagccagttctcccatgacgtgatatgttt
ccagagcaggttcctgggtgagataaaaggatttgggctgaacagggtggagggagcatt
GGAATGGCACTCAGGGCAAAGGCAGAGGTGTGCGTGGCAGCGCCCTGGCTGTCCCTGCAA
AGGGCACGGGCACTGGGCACTAGAGCCGCTCGGGCCCCTAGGACGGTGCTGCCGTTTGAA
GCCATGCCCCAGCATCCAGGCAACAGGTGGCTGAGGCTGCTGCAGATCTGGAGGGAGCAG
GGTTATGAGCACCTGCACCTGGAGATGCACCAGACCTTCCAGGAGCTGGGGCCCATTTTC
AG
gtaaagccctccctggccctcgctgggaacacccagatccctgcccctgctgcccaggac
cctgccaggcactcagcactgccattcccagcaggtcccggcactctgcatcctttggag
gatggggaaggagtgcagcacatgctggtctgtggtgctgccagggcaggggatagtgca
EXON 2  156 bp
ggcaggactcagaagcactaaagttgaaaggttccagggagccagcaggagggctttagc
tgtgaagccgctaatccaggagcagggagggtggacaggagacactttggattgggactg
cagggtggggccacgagggacatgaccccgtccagcagggcctcctgcttggccccacag
GTACAACTTGGGAGGACCACGCATGGTGTGTGTGATGCTGCCGGAGGATGTGGAGAAGCT
GCAACAGGTGGACAGCCTGCATCCCTGCAGGATGATCCTGGAGCCCTGGGTGGCCTACAG
ACAACATCGTGGGCACAAATGTGGCGTGTTCTTGTT
gtaagcggcgagttgggagctgagagctgggagcagggtgggcagcctgggtgtaggggg
gaggcgagagaggtaggacccaaaagcacatctgccctgggcccctgtggtgggcagtga
gggtgagcacccggcccagaggacggccatcctgtggggtcgcgtctgcactgtgggttg
EXON 3  200 bp
cagcacctggaggccgctctgagaaaaggctgcagctcgaacacaaacaggcagcttcta
ccagggcccccagtcagctccctgcaggccgattccccttggggacaaggaggatgggat
acgggtcagggcctgtgtcttgctggggcggcctcacaagctctgccctggcctctgtag
GAATGGGCCTGAATGGCGCTTCAACCGATTGCGGCTGAACCCAGATGTGCTGTCGCCCAA
GGCCGTGCAGAGGTTCCTCCCGATGGTGGATGCAGTGGCCAGGGACTTCTCCCAGGCCCT
GAAGAAGAAGGTGCTGCAGAACGCCCGGGGGAGCCTGACCCTGGACGTCCAGCCCAGCAT
CTTCCACTACACCATAGAAG
gtgtgggccatgcgggaaggtccagccccagagaccctggagtggccagggatggggatg
gaggactgaagggagtgtggggaggcagccaggaggcctggggctgccttgtgctcagca
gtgcatcctccccgcagccagcaacttagctctttttggagagcggctgggcctggttgg
EXON 4  204 bp
accctggacgtccagcccagcatcttccactacaccatagaaggtgtgggccatgcggga
aggtccagccccagagaccctggagtggccagggatggggatggaggactgaagggagtg
tggggaggcagccaggaggcctggggctgccttgtgctcagcagtgcatcctccccgcag
CCAGCAACTTAGCTCTTTTTGGAGAGCGGCTGGGCCTGGTTGGCCACAGCCCCAGTTCTG
CCAGCCTGAACTTCCTCCATGCCCTGGAGGTCATGTTCAAATCCACCGTCCAGCTCATGT
TCATGCCCAGGAGCCTGTCTCGCTGGATCAGCCCCAAGGTGTGGAAGGAGCACTTTGAGG
CCTGGGACTGCATCTTCCAGTACG
gtgaggccagggacccgggcagtgctatggggaagggacaccatgggggcccaatttctc
cttctccaccacccagtggggaatggaggccacagggaggggtcggggattcctcacctt
cctgccggggagattggtgcgaggctggggctgggctgggctgatccggagaatttggga
EXON 5  155 bp
ggattcctcaccttcctgccggggagattggtgcgaggctggggctgggctgggctgatc
cggagaatttgggatgagagcagggagatttgggtgtcggggcagtctgggcaggaggag
gacactgaaggatgcttcccagcaccaagatctgagggctgtcccctgctccctggacag
GTGACAACTGTATCCAGAAAATCTACCAGGAACTGGCCTTCAACCGCCCTCAACACTACA
CAGGCATCGTGGCGGAGCTCCTGTTGAAGGCGGAACTGTCACTAGAAGCCATCAAGGCCA
ACTCTATGGAACTCACTGCAGGGAGCGTGGACACG
gtcaggccagcaaccagccccacccagagagggtgatgccaagcctgcctcccaggcact
gcctgccaatgccacacggcacccacgttccccatccccaggctacaggccccacatttc
tgttgccctcagccttccccctcctttgttaagggatgagatttgcaggggaggggaaat
EXON 6  167 bp
aagaagtcagggaatctggcccaagtggtcatcaaggtttcagatccggggtcccagggc
tctgtttttgctcagggcatggatgtctccacccctcagagggaggttgtcctgggaggg
gtgtcccgggggctgagtcctcctgtgcaaggtctgaccctgcagacatggcttctgtag
ACAGCGTTTCCCTTGCTGATGACGCTCTTTGAGCTGGCTCGGAACCCCGACGTGCAGCAG
ATCCTGCGCCAGGAGAGCCTGGCCGCCGCAGCCAGCATCAGTGAACATCCCCAGAAGGCA
ACCACCGAGCTGCCCTTGCTGCGGGCGGCCCTCAAGGAGACCTTGCG
gtgggtgctggctgaggcctccctgtggccctggccccctgctggagagcagcccccact
gggtggtggcagacagaatctggggctgataaacagcgtcacccagcagcccattcccct
gcacctgctcttcctccccctcaaggacagggagctcttcttcctctggaatccctcttc
EXON 7  79 bp
ttggggcttctcaagttaggggaggtttggctgggctcagcaggtgcaaggaagtacttc
ctacgacctgggcttcccatggatctgggacctctgcggggtcttcggtaggaagggtgc
agagagcacaggaagccccatccagctgaggaccctttctatggatgcccccacctccag
GCTCTACCCTGTGGGTCTGTTTTTGGAGCGAGTGGTGAGCTCAGACTTGGTGCTTCAGAA
CTACCACATCCCAGCTGGG
gtgagtgagccccacacccctcgagctgagaacctccctccccagtcattccctgatccc
tgctctgcaccgtccgcagacattggtacaggttttcctctactcgctgggtcgcaatgc
cgccttgttcccgaggcctgagcggtataatccccagcgctggctagacatcaggggctc
EXON 8  198 bp
ctatggatgcccccacctccaggctctaccctgtgggtctgtttttggagcgagtggtga
gctcagacttggtgcttcagaactaccacatcccagctggggtgagtgagccccacaccc
ctcgagctgagaacctccctccccagtcattccctgatccctgctctgcaccgtccgcag
ACATTGGTACAGGTTTTCCTCTACTCGCTGGGTCGCAATGCCGCCTTGTTCCCGAGGCCT
GAGCGGTATAATCCCCAGCGCTGGCTAGACATCAGGGGCTCCGGCAGGAACTTCCACCAC
GTGCCCTTTGGCTTTGGCATGCGCCAGTGCCTCGGGCGGCGCCTGGCAGAGGCAGAGATG
CTGCTGCTGCTGCACCAC
gtaagcaggcctgggggcgggggcgggacctgggcagcagaggcgggacctgcacactgg
gggcggggcttgcatggtgtgattgacacctgggaacagtggatggggccttggttggtt
gaggtcggcgtgaccagggaggatctgtgctgagcaagacagggtaggatctgggtgagg
EXON 9  1535 bp
tgggcaggattcagtctgggcctggtccgtaaggtggggctggtcagaagtgggataggt
tggggcccaggctgctgctcccccttcagcataattgttgcacctgggacgatgggagga
agctgccccaggtccatgggctactgaccaggccagatggaaacccagcctctgtcctag
GTGCTGAAGCACTTCCTGGTGGAGACACTAACTCAAGAGGACATAAAGATGGTCTACAGC
TTCATATTGAGGCCTGGCACGTCCCCCCTCCTCACTTTCAGAGCGATTAACTAGTCTTGC
ATCTGCACCCAGGGTCCCAGCCTGGCCACCAGCTTCCCTCTGCCTGACCCCAGGCCACCT
GTCTTCTCTCCCACGTGCACAGCTTCCTGAGTCACCCCTCTGTCCAGCCAGCTCCTGCAC
AAATGGAACTCCCCAGGGCCTCCAGGACTGGGGCTTGCCAGGCTTGTCAAATAGCAAGGC
CAGGGCACAGCTGGAGACGATCTTGCTGGCAGGGCCTGGCCTTGTCCCCAGCTCCACCTG
GCCCCTTCTCCAGCAAGCAGTGCCCTCTGGACAGCTTGACTCTACTCCCAGCGCTGGCTC
CAGGCTCCTCATGAGGCCATGCAAGGGTGCTGTGATTTTGTCCCTTGCCTTCCTGCCTAG
TCTCACATGTCCCTGTCCCTCTCGCCCTGGCCAGGGCCTCTGTGCAGACAGTGTCAGAGT
CATTAAGCGGGATCCCAGCATCTCAGAGTCCAGTCAAGTTCCCTCCTGCAGCCTGACCCC
AGGCAGCTCGAGCATGCCCTGAGCTCTCTGAAAGTTGTCACCCTGGAATACGATCCTGCA
GGGTAGACTAAAAAGGCCCCTGTGGTCACTTATCCTGACACATTTTCAAGTGATACAACT
GAGTCTCGAGGGGCGTGTGTTCCCCAGCTGATCATGTCAGCCTCATGCCCCAGGCCTCGT
CTTTCATGGACCAGGTCTTGTTCAAGCAGCGAGTGTTGGGTCCTCTGCTTCCTGAGCTGT
CCCCTGGAGAAGGTCCCGAGGATGCTGTCAGGAGATGGAAGAGTCATGTGGGGTGGGAAC
CTGGGGTGTGGTTCCAGAAATGTTTTTGGCAACAGGAGAGACAGGATTGGGCCAACAAGG
ACTCAGATGAGTTTTATTGACTCATTCCTCTGGTTGATACGGAGCCATGTCATGTGCCAC
GACCTGGGGTGGGCACAGGGAGGCTGCAGTTCCCTACGTGAACCTGCCTTGGGCCTCATC
TGCTCCTAGCCCAGCAGAGAGAGTTGACCCCTCCTGAACTGGCCACTCCCCAGTGCTCCT
GTGCAGGGATAGGAAGTGCCCCAGGGTGAGAACGTGCCCAGCCACATCATCTTTATCTCC
TGGGATTTTCATTAGGGCAAAGATCTCAGCAGCCAGCTCCTGGTAGCTGATGAGGATCAG
AGCGTTTGTTCCCCCATGAAAGGGGAAATACTTAGGTAATCATTCCAGGTGTGTTCAGTA
GTTCCAGGACTCAGGGACTCAGGCCAGTCACCCTGTGACCGCAGGTTGCTTTCCCACCCT
GGGCAATGCAGTGCAGCATGGGAAAGGAATAAGGGGGCAACAAGGTGCACAGACCTCAGA
GATGGCTTCCTTGTTTATGGGGCTCTCACAGATACCCATCCAACTCCTCTAGTCAGCACT
AGATCATGGGATCCTAAAATAAACCTTGGAAAAAT
attttaaagccttttatctcaaaattattatagatatattcaaatttgttgacatatata
tacaggcaggtccccccgccacccttcacacagcctcccaccatcagcagcttgcaatta
catagaacagtcttcaaaacaggaaatggacagtggcacgattcactgagcttatttaga