Gene CEBPD Variant 1
DNA : 1.29 KbNT_008183
mRNA : 1295 bp NM_005195
CDS : 810 bp NP_005186
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  1295 bp
caccctcctgcaacgtgggctgggggtccccagggccggggagggggccccggggaggaa
ctgagagggggcgcgccccgggaaggctcggggcggctccggggggctcccagggcgccc
ccgccccttcccccgcggccccggggcgcccccgcggtgccggagtcggggcggggcgtg
CACGTCAGCCGGGGCTAGAAAAGGCGGCGGGGCTGGGCCCAGCGAGGTGACAGCCTCGCT
TGGACGCAGAGCCCGGCCCGACGCCGCCATGAGCGCCGCGCTCTTCAGCCTGGACGGCCC
GGCGCGCGGCGCGCCCTGGCCTGCGGAGCCTGCGCCCTTCTACGAACCGGGCCGGGCGGG
CAAGCCGGGCCGCGGGGCCGAGCCAGGGGCCCTAGGCGAGCCAGGCGCCGCCGCCCCCGC
CATGTACGACGACGAGAGCGCCATCGACTTCAGCGCCTACATCGACTCCATGGCCGCCGT
GCCCACCCTGGAGCTGTGCCACGACGAGCTCTTCGCCGACCTCTTCAACAGCAATCACAA
GGCGGGCGGCGCGGGGCCCCTGGAGCTTCTTCCCGGCGGCCCCGCGCGCCCCTTGGGCCC
GGGCCCTGCCGCTCCCCGCCTGCTCAAGCGCGAGCCCGACTGGGGCGACGGCGACGCGCC
CGGCTCGCTGTTGCCCGCGCAGGTGGCCGCGTGCGCACAGACCGTGGTGAGCTTGGCGGC
CGCAGGGCAGCCCACCCCGCCCACGTCGCCGGAGCCGCCGCGCAGCAGCCCCAGGCAGAC
CCCCGCGCCCGGCCCCGCCCGGGAGAAGAGCGCCGGCAAGAGGGGCCCGGACCGCGGCAG
CCCCGAGTACCGGCAGCGGCGCGAGCGCAACAACATCGCCGTGCGCAAGAGCCGCGACAA
GGCCAAGCGGCGCAACCAGGAGATGCAGCAGAAGTTGGTGGAGCTGTCGGCTGAGAACGA
GAAGCTGCACCAGCGCGTGGAGCAGCTCACGCGGGACCTGGCCGGCCTCCGGCAGTTCTT
CAAGCAGCTGCCCAGCCCGCCCTTCCTGCCGGCCGCCGGGACAGCAGACTGCCGGTAACG
CGCGGCCGGGGCGGGAGAGACTCAGCAACGACCCATACCTCAGACCCGACGGCCCGGAGC
GGAGCGCGCCCTGCCCTGGCGCAGCCAGAGCCGCCGGGTGCCCGCTGCAGTTTCTTGGGA
CATAGGAGCGCAAAGAAGCTACAGCCTGGACTTACCACCACTAAACTGCGAGAGAAGCTA
AACGTGTTTATTTTCCCTTAAATTATTTTTGTAATGGTAGCTTTTTCTACATCTTACTCC
TGTTGATGCAGCTAAGGTACATTTGTAAAAAGAAAAAAAACCAGACTTTTCAGACAAACC
CTTTGTATTGTAGATAAGAGGAAAAGACTGAGCATGCTCACTTTTTTATATTAATTTTTA
CAGTATTTGTAAGAATAAAGCAGCATTTGAAATCG
cccctgcttcctatattcgcagtgactcccgcccgcccgccggtggcgcaggacccggct
cgggaagggtgcgttccggacccgcagccagcgagcaccagggagcccgggcgccaggtg
tgtgtgtggggggggcggggggatggggcgcaggcccgagctactcaggagagagggtct