Gene ANK1 Variant 8
DNA : 9.95 KbNT_008251
mRNA : 1184 bp NM_020478
CDS : 468 bp NP_065211
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  470 bp
ttccaggtctctgggcagggcggggttaggcagcagcgggtgtcactcacacagtgactt
tcacttgtgctttcagtgctcaggacatgggcacctgccggcttccttctagcccggttg
gacagctccggcagctggtttggggaggtaaaattataggagcgtgatgtcacccgggcc
ACTCAGGGCAGAGCCTGGCTGCTGGGCAGAAGGGCACTTGGGCCGGGCTGCTTCAGCCGA
GAGGGCCATTCGGTGTCCTGCCCACAGAGAGAGAAACAGTGAGAGACCAAGAGAGCAAAC
CAGAGAGATAGGGAGGGGGAATGCAAGGGGTCCCTGGGGGACTCAGGAGTCCCAGTGGAG
AATGAGAGGCAGGCCCCCCGTGGTGGCCGGGGCCCTGGCTGCCAGAGGACCGGGCTGGTG
AGGAGGCGAGGATGTGGACTTTCGTCACCCAGCTGTTGGTCACGCTGGTGCTGCTGAGCT
TCTTCCTGGTCAGCTGTCAGAACGTGATGCACATTGTCAGGGGGTCCCTGTGCTTTGTGC
TAAAGCACATCCACCAGGAGCTGGACAAGGAGCTGGGGGAGAGCGAGGGCCTCAGTGACG
ACGAGGAGACCATCTCCACCAGGGTGGTCCGGCGGCGGGTCTTCCTGAAG
gtaaccgcctggcaggaggccggcagggctggtggtgtgggcgccggaggccggggctga
ggggacgctgctgtggggagctccggacccagagttgggagacgccggaggaaaaggacc
aggaggcccccagggatcatgttccaccctgggagccagagtgtgtgtgcgcccaccaga
EXON 2  84 bp
gccgcccacgccctgggagccctggcatggctcctgctacatgctgagccgggtttcctg
ctgggggagttattgggccatggctattgtggctactgctgtttcatttcctcgtcctcc
acccttcctcccagactcccactcaccaatcttgcattttctccctttctctaattccag
GGGAATGAGTTTCAGAATATTCCAGGGGAGCAGGTGACAGAGGAGCAATTCACGGATGAG
CAGGGCAACATTGTCACCAAGAAG
gtgggtgcagagtgttcccctctgtgctggggagaggcaggtgggctagaagctaaaagg
tggtagaagccagtggcttctccctgctgccctcacagcaggtgagcacagccaggctgg
ctgcccccgtgctcaggagggatggagggcccaggagctgggagctttggtcatctgcag
EXON 3  66 bp
ccacaccgggctaatttttgtatttttagtagagacagggtttcaccatgttggccaggc
tggtctcaaactcctgacctcagatgatctgcacgtcagcctcccaaagtgctgagatta
cagacatgagcccccgagcccggcctgaccagccctttcctccttcccttcctttcctag
ATCATTCGCAAGGTGGTTCGACAGATAGACTTGTCCAGCGCCGATGCCGCCCAGGAGCAC
GAGGAG
gtgactgtagaggggcccctggaggatcccagtgagctggaggtcgatattgattacttt
atgaaacactccaaggtactgaggcgcccgcggccctgggggacccagcgccatcactgc
tgccttgctctgccgggccgtctgcatgacacctccctccactcacctctttatgagctc
EXON 4  135 bp
gccgggccgtctgcatgacacctccctccactcacctctttatgagctctctctccagtc
tctcttctccctggtgggcagtgtgtctgccacctccgtgtggcctcctttcgatcttct
gcctgtgttctgcccgtctttgcgatctgtcctgctttctgtctctgctgctgtctgcag
GTGGAGCTGAGAGGGAGTGGCCTACAGCCGGACCTGATAGAGGGCAGGAAGGGGGCGCAG
ATAGTGAAGCGGGCCAGCCTGAAAAGGGGGAAACAGTGACCCCGAGCCGCTCTCCTTGGA
GTAGCCTCTCGGGAG
gtaacgctgcccttctcatcccctctgcatggcctggtcttcagtggagtggctgctccc
tgtctcaccctatcccctcccagccaccccagcatgatgtgggacaaacaacttgttgtt
gtgtctcgaggcagagattctcacttcccaaccctgctaacagttggctctgaaccccag
EXON 5  429 bp
gcatctcaggaagtcgggctgcaagtgcagcaccctcagcacatcgccctgcctggggag
actgcttttcctgagtcagattcggcctgagctgccagcacaaaactctgtgtgtggggt
ttttgctggacgttgcacttttgcattctaagtgactccttctctctttgtgtctcccag
GATCACACCTCGACACCCAACCCCTGAACCCCACACACTCTGCCATGCACACAGGAGGAG
AGCTGGACCTGAGGGCCACCGCAGCGGTGCACACATTCCTCTGGGCTGACGGCATGACCT
CTGTAAGGGACTCCTGCTAGTCCCCTCTTGGCATGAATGACTGACTGTAGACGCATGACC
TCCAGGCTTCAATCCTGCCTCTTGCAATGACAGCTGATCTGTCGGAACCAGGACACAAAA
GCAGCAAGAAGCGGGGAGAGAGAGGGATAGAAAACAAGCGCAGGAGAGCCTGCGAACGCA
AAAGTGAATGAGGGCTTTTTGTGGCTGGGGATGGGTTTTGGTTTTGGGGTTTTTTTTTTA
AATTGTTTTGACTTCGTACAGGGTACTTTTTCCCAACCTCATCTGTCAGAAATCCATGTG
GGCTTCCTG
gaaagaaaaaaaaaaaaaagaaaactaggcatgaaatcagtttaacaccttaatcttaag
ccatgtcctcatctgcccaccctccccaacccacatacctccattccacttgtgacaccc
cctcgactccctggtgacgctcctcccagatcgctctacatgacattcaggacacacaca