Gene ANK1 Variant 6
DNA : 9.95 KbNT_008251
mRNA : 983 bp NM_020480
CDS : 330 bp NP_065213
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  470 bp
ttccaggtctctgggcagggcggggttaggcagcagcgggtgtcactcacacagtgactt
tcacttgtgctttcagtgctcaggacatgggcacctgccggcttccttctagcccggttg
gacagctccggcagctggtttggggaggtaaaattataggagcgtgatgtcacccgggcc
ACTCAGGGCAGAGCCTGGCTGCTGGGCAGAAGGGCACTTGGGCCGGGCTGCTTCAGCCGA
GAGGGCCATTCGGTGTCCTGCCCACAGAGAGAGAAACAGTGAGAGACCAAGAGAGCAAAC
CAGAGAGATAGGGAGGGGGAATGCAAGGGGTCCCTGGGGGACTCAGGAGTCCCAGTGGAG
AATGAGAGGCAGGCCCCCCGTGGTGGCCGGGGCCCTGGCTGCCAGAGGACCGGGCTGGTG
AGGAGGCGAGGATGTGGACTTTCGTCACCCAGCTGTTGGTCACGCTGGTGCTGCTGAGCT
TCTTCCTGGTCAGCTGTCAGAACGTGATGCACATTGTCAGGGGGTCCCTGTGCTTTGTGC
TAAAGCACATCCACCAGGAGCTGGACAAGGAGCTGGGGGAGAGCGAGGGCCTCAGTGACG
ACGAGGAGACCATCTCCACCAGGGTGGTCCGGCGGCGGGTCTTCCTGAAG
gtaaccgcctggcaggaggccggcagggctggtggtgtgggcgccggaggccggggctga
ggggacgctgctgtggggagctccggacccagagttgggagacgccggaggaaaaggacc
aggaggcccccagggatcatgttccaccctgggagccagagtgtgtgtgcgcccaccaga
EXON 2  84 bp
gccgcccacgccctgggagccctggcatggctcctgctacatgctgagccgggtttcctg
ctgggggagttattgggccatggctattgtggctactgctgtttcatttcctcgtcctcc
acccttcctcccagactcccactcaccaatcttgcattttctccctttctctaattccag
GGGAATGAGTTTCAGAATATTCCAGGGGAGCAGGTGACAGAGGAGCAATTCACGGATGAG
CAGGGCAACATTGTCACCAAGAAG
gtgggtgcagagtgttcccctctgtgctggggagaggcaggtgggctagaagctaaaagg
tggtagaagccagtggcttctccctgctgccctcacagcaggtgagcacagccaggctgg
ctgcccccgtgctcaggagggatggagggcccaggagctgggagctttggtcatctgcag
EXON 3  429 bp
gcatctcaggaagtcgggctgcaagtgcagcaccctcagcacatcgccctgcctggggag
actgcttttcctgagtcagattcggcctgagctgccagcacaaaactctgtgtgtggggt
ttttgctggacgttgcacttttgcattctaagtgactccttctctctttgtgtctcccag
GATCACACCTCGACACCCAACCCCTGAACCCCACACACTCTGCCATGCACACAGGAGGAG
AGCTGGACCTGAGGGCCACCGCAGCGGTGCACACATTCCTCTGGGCTGACGGCATGACCT
CTGTAAGGGACTCCTGCTAGTCCCCTCTTGGCATGAATGACTGACTGTAGACGCATGACC
TCCAGGCTTCAATCCTGCCTCTTGCAATGACAGCTGATCTGTCGGAACCAGGACACAAAA
GCAGCAAGAAGCGGGGAGAGAGAGGGATAGAAAACAAGCGCAGGAGAGCCTGCGAACGCA
AAAGTGAATGAGGGCTTTTTGTGGCTGGGGATGGGTTTTGGTTTTGGGGTTTTTTTTTTA
AATTGTTTTGACTTCGTACAGGGTACTTTTTCCCAACCTCATCTGTCAGAAATCCATGTG
GGCTTCCTG
gaaagaaaaaaaaaaaaaagaaaactaggcatgaaatcagtttaacaccttaatcttaag
ccatgtcctcatctgcccaccctccccaacccacatacctccattccacttgtgacaccc
cctcgactccctggtgacgctcctcccagatcgctctacatgacattcaggacacacaca