Gene ANK1 Variant 5
DNA : 9.95 KbNT_008251
mRNA : 941 bp NM_020481
CDS : 483 bp NP_065214
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  377 bp
ttccaggtctctgggcagggcggggttaggcagcagcgggtgtcactcacacagtgactt
tcacttgtgctttcagtgctcaggacatgggcacctgccggcttccttctagcccggttg
gacagctccggcagctggtttggggaggtaaaattataggagcgtgatgtcacccgggcc
ACTCAGGGCAGAGCCTGGCTGCTGGGCAGAAGGGCACTTGGGCCGGGCTGCTTCAGCCGA
GAGGGCCATTCGGTGTCCTGCCCACAGAGAGAGAAACAGTGAGAGACCAAGAGAGCAAAC
CAGAGAGATAGGGAGGGGGAATGCAAGGGGTCCCTGGGGGACTCAGGAGTCCCAGTGGAG
AATGAGAGGCAGGCCCCCCGTGGTGGCCGGGGCCCTGGCTGCCAGAGGACCGGGCTGGTG
AGGAGGCGAGGATGTGGACTTTCGTCACCCAGCTGTTGGTCACGCTGGTGCTGCTGAGCT
TCTTCCTGGTCAGCTGTCAGAACGTGATGCACATTGTCAGGGGGTCCCTGTGCTTTGTGC
TAAAGCACATCCACCAG
gagctggacaaggagctgggggagagcgagggcctcagtgacgacgaggagaccatctcc
accagggtggtccggcggcgggtcttcctgaaggtaaccgcctggcaggaggccggcagg
gctggtggtgtgggcgccggaggccggggctgaggggacgctgctgtggggagctccgga
EXON 2  135 bp
gccgggccgtctgcatgacacctccctccactcacctctttatgagctctctctccagtc
tctcttctccctggtgggcagtgtgtctgccacctccgtgtggcctcctttcgatcttct
gcctgtgttctgcccgtctttgcgatctgtcctgctttctgtctctgctgctgtctgcag
GTGGAGCTGAGAGGGAGTGGCCTACAGCCGGACCTGATAGAGGGCAGGAAGGGGGCGCAG
ATAGTGAAGCGGGCCAGCCTGAAAAGGGGGAAACAGTGACCCCGAGCCGCTCTCCTTGGA
GTAGCCTCTCGGGAG
gtaacgctgcccttctcatcccctctgcatggcctggtcttcagtggagtggctgctccc
tgtctcaccctatcccctcccagccaccccagcatgatgtgggacaaacaacttgttgtt
gtgtctcgaggcagagattctcacttcccaaccctgctaacagttggctctgaaccccag
EXON 3  429 bp
gcatctcaggaagtcgggctgcaagtgcagcaccctcagcacatcgccctgcctggggag
actgcttttcctgagtcagattcggcctgagctgccagcacaaaactctgtgtgtggggt
ttttgctggacgttgcacttttgcattctaagtgactccttctctctttgtgtctcccag
GATCACACCTCGACACCCAACCCCTGAACCCCACACACTCTGCCATGCACACAGGAGGAG
AGCTGGACCTGAGGGCCACCGCAGCGGTGCACACATTCCTCTGGGCTGACGGCATGACCT
CTGTAAGGGACTCCTGCTAGTCCCCTCTTGGCATGAATGACTGACTGTAGACGCATGACC
TCCAGGCTTCAATCCTGCCTCTTGCAATGACAGCTGATCTGTCGGAACCAGGACACAAAA
GCAGCAAGAAGCGGGGAGAGAGAGGGATAGAAAACAAGCGCAGGAGAGCCTGCGAACGCA
AAAGTGAATGAGGGCTTTTTGTGGCTGGGGATGGGTTTTGGTTTTGGGGTTTTTTTTTTA
AATTGTTTTGACTTCGTACAGGGTACTTTTTCCCAACCTCATCTGTCAGAAATCCATGTG
GGCTTCCTG
gaaagaaaaaaaaaaaaaagaaaactaggcatgaaatcagtttaacaccttaatcttaag
ccatgtcctcatctgcccaccctccccaacccacatacctccattccacttgtgacaccc
cctcgactccctggtgacgctcctcccagatcgctctacatgacattcaggacacacaca